Rmu_sc0008598.1_g000014

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008598.1
OG0000914
Physical Location & Seq
Reverse (-)
41822 .. 42349
528 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008598.1_g000014.1.cds

Sequence Viewer

Length: 384 bp
atgtgcaggaatgatccagcttggttcaaggaatgggaagacatgttgcagagtgagtatgacgaatttggctatccaagcactgatgaagaacagatcaacacagtggagaattggcaagatgtagcaatgttgaaacaagatatggcaggaagcgttattgagagctgcaagaggaaggttgaaaaagatgaagaggccaatgaagatgctgctgctgctgctgctcctgctattgctgctgctgttcctgctcatgctactgctcctacaaatgaaccaaggacacgatcaaccataaagagaatcaaagaaagaacagatcggaaagagaagcaactagaaggttttgaggtgcagaaaccatcgaagaaacagaggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

127

Amino Acids

14.49

Weight (kDa)

4.95

Isoelectric Point (pI)

59.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 8
AcsI RAATTY 1 cut(s) 65
AflIII ACRYGT 1 cut(s) 42
AgsI TTSAA 3 cut(s) 28, 136, 185
AluBI AGCT 2 cut(s) 20, 168
AluI AGCT 2 cut(s) 20, 168
AlwI GGATC 1 cut(s) 8
AoxI GGCC 1 cut(s) 198
ApeKI GCWGC 8 cut(s) 168, 212, 215, 218, 221, 224, 239, 242
ApoI RAATTY 1 cut(s) 65
BbsI GAAGAC 1 cut(s) 45
BbvI GCAGC 8 cut(s) 155, 199, 202, 205, 208, 211, 226, 229
BccI CCATC 1 cut(s) 373
BfaI CTAG 1 cut(s) 341
BisI GCNGC 8 cut(s) 169, 213, 216, 219, 222, 225, 240, 243
BlsI GCNGC 8 cut(s) 170, 214, 217, 220, 223, 226, 241, 244
BmsI GCATC 1 cut(s) 199
BpiI GAAGAC 1 cut(s) 45
BsaJI CCNNGG 1 cut(s) 281
Bse3DI GCAATG 1 cut(s) 135
BseDI CCNNGG 1 cut(s) 281
BseMI GCAATG 1 cut(s) 135
BseXI GCAGC 8 cut(s) 155, 199, 202, 205, 208, 211, 226, 229
BsgI GTGCAG 2 cut(s) 25, 377
BshFI GGCC 1 cut(s) 200
BsnI GGCC 1 cut(s) 200
Bsp143I GATC 4 cut(s) 13, 96, 290, 322
BspANI GGCC 1 cut(s) 200
BspPI GGATC 1 cut(s) 8
BsrDI GCAATG 1 cut(s) 135
BssECI CCNNGG 1 cut(s) 281
BssMI GATC 4 cut(s) 13, 96, 290, 322
BssT1I CCWWGG 1 cut(s) 281
Bst4CI ACNGT 1 cut(s) 106
Bst6I CTCTTC 1 cut(s) 189
BstKTI GATC 4 cut(s) 16, 99, 293, 325
BstMBI GATC 4 cut(s) 13, 96, 290, 322
BstMWI GCNNNNNNNGC 7 cut(s) 78, 218, 221, 224, 230, 239, 251
BstNSI RCATGY 1 cut(s) 46
BstV1I GCAGC 8 cut(s) 155, 199, 202, 205, 208, 211, 226, 229
BstV2I GAAGAC 1 cut(s) 45
BsuRI GGCC 1 cut(s) 200
BtsIMutI CAGTG 2 cut(s) 81, 111
CviAII CATG 2 cut(s) 43, 257
CviJI RGCY 4 cut(s) 20, 72, 168, 200
CviKI_1 RGCY 4 cut(s) 20, 72, 168, 200
DpnI GATC 4 cut(s) 15, 98, 292, 324
DpnII GATC 4 cut(s) 13, 96, 290, 322
Eam1104I CTCTTC 1 cut(s) 189
EarI CTCTTC 1 cut(s) 189
Eco130I CCWWGG 1 cut(s) 281
EcoT14I CCWWGG 1 cut(s) 281
ErhI CCWWGG 1 cut(s) 281
FaeI CATG 2 cut(s) 46, 260
FaiI YATR 5 cut(s) 44, 60, 146, 258, 299
FatI CATG 2 cut(s) 42, 256
Fnu4HI GCNGC 8 cut(s) 169, 213, 216, 219, 222, 225, 240, 243
Fsp4HI GCNGC 8 cut(s) 169, 213, 216, 219, 222, 225, 240, 243
FspBI CTAG 1 cut(s) 341
GluI GCNGC 8 cut(s) 169, 213, 216, 219, 222, 225, 240, 243
HaeIII GGCC 1 cut(s) 200
Hin1II CATG 2 cut(s) 46, 260
HinfI GANTC 1 cut(s) 306
Hpy188I TCNGA 1 cut(s) 327
HpyAV CCTTC 2 cut(s) 172, 338
HpyCH4III ACNGT 1 cut(s) 106
HpyCH4V TGCA 4 cut(s) 6, 49, 171, 358
HpyF10VI GCNNNNNNNGC 7 cut(s) 78, 218, 221, 224, 230, 239, 251
Hsp92II CATG 2 cut(s) 46, 260
Kzo9I GATC 4 cut(s) 13, 96, 290, 322
LmnI GCTCC 2 cut(s) 232, 271
LpnPI CCDG 4 cut(s) 30, 135, 243, 264
Lsp1109I GCAGC 8 cut(s) 155, 199, 202, 205, 208, 211, 226, 229
LweI GCATC 1 cut(s) 199
MaeI CTAG 1 cut(s) 341
MalI GATC 4 cut(s) 15, 98, 292, 324
MboI GATC 4 cut(s) 13, 96, 290, 322
MboII GAAGA 5 cut(s) 50, 101, 206, 218, 382
MluCI AATT 2 cut(s) 65, 112
MnlI CCTC 4 cut(s) 168, 190, 346, 372
MwoI GCNNNNNNNGC 7 cut(s) 78, 218, 221, 224, 230, 239, 251
NdeII GATC 4 cut(s) 13, 96, 290, 322
NlaIII CATG 2 cut(s) 46, 260
NspI RCATGY 1 cut(s) 46
PciI ACATGT 1 cut(s) 42
PfeI GAWTC 1 cut(s) 306
PkrI GCNGC 8 cut(s) 170, 214, 217, 220, 223, 226, 241, 244
PscI ACATGT 1 cut(s) 42
SatI GCNGC 8 cut(s) 169, 213, 216, 219, 222, 225, 240, 243
Sau3AI GATC 4 cut(s) 13, 96, 290, 322
SetI ASST 6 cut(s) 22, 170, 183, 349, 357, 383
SfaNI GCATC 1 cut(s) 199
Sse9I AATT 2 cut(s) 65, 112
SspMI CTAG 1 cut(s) 341
StyI CCWWGG 1 cut(s) 281
TaaI ACNGT 1 cut(s) 106
TaqI TCGA 1 cut(s) 368
TasI AATT 2 cut(s) 65, 112
TfiI GAWTC 1 cut(s) 306
TscAI CASTG 2 cut(s) 88, 111
TseI GCWGC 8 cut(s) 168, 212, 215, 218, 221, 224, 239, 242
TspDTI ATGAA 4 cut(s) 102, 207, 219, 291
TspRI CASTG 2 cut(s) 88, 111
XapI RAATTY 1 cut(s) 65
XceI RCATGY 1 cut(s) 46
XspI CTAG 1 cut(s) 341
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.