Rmu_sc0003374.1_g000001

NmrA-like family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003374.1
OG0000709
Physical Location & Seq
Reverse (-)
1 .. 1720
1720 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003374.1_g000001.1.cds

Sequence Viewer

Length: 730 bp
atgggcggagagaggaaggttgtgtgtgttacaggagcttctggtttcatagcttcatggctggtgaagattttgttacagcgaggttatgtcgtcaaagccaccgttcgtgacccaggagcttctggtttcatagcttcatggctggtgaagattttgttacagcgaggttatgtcgtcaaagccaccgttcgtgacccagatgatccaaagaaaacagaacacttgctctcacttgatggagcaaaggaaaggcttcatttgttcaaagcagaattgttagaagaggggtcttttgaccttgtagttgatggatgtgaaggtgttttccatacagcatctccggtactattttcatcgatcagtgacccacaggcagaactgattgatcctgcagtaaagggaacgcttaatgttcttaaatcatgcgtgaaatttccaacaatcaagagggtagttttaacatcttccatggctgcagttattatcaatggaagacctttaacctctaatgtagaagttgatgaaacatggttttctgatccacttgtttgtgaggagttgaaggcatggtatttactttcaaaaactttagcagaggaggctgcttggaaatttgctaaagaaaatgggattgacatggtgaccataaatccagcgtatgtgatgggtccactcttgcagccaactcttaattacactgtggagatggttctgaatctcaagaatg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Epimerase

Protein Analysis

243

Amino Acids

26.65

Weight (kDa)

5.98

Isoelectric Point (pI)

20.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000709)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g01511 FvH4_7g01511 FvH4_7g01511 FvH4_7g01520 FvH4_7g01520 FvH4_7g01520 FvH4_7g01520 FvH4_7g01560 FvH4_7g01560
malus_domestica MD02G1303400.v1.1 MD02G1303800.v1.1 MD02G1303900.v1.1 MD02G1304200.v1.1 MD02G1304400.v1.1 MD02G1304900.v1.1 MD02G1305300.v1.1 MD02G1305400.v1.1 MD04G1006100.v1.1 MD07G1020300.v1.1 MD07G1020900.v1.1 MD07G1021200.v1.1 MD07G1021500.v1.1
prunus_persica Prupe.2G020700_v2.0.a1 Prupe.2G021000_v2.0.a1 Prupe.2G021100_v2.0.a1 Prupe.2G021300_v2.0.a1 Prupe.2G021300_v2.0.a1 Prupe.2G021500_v2.0.a1 Prupe.2G021500_v2.0.a1 Prupe.2G021500_v2.0.a1
pyrus_communis pycom02g25550 pycom02g25560 pycom02g25570 pycom02g25590 pycom07g01560 pycom07g01570 pycom07g01630
rosa_chinensis RchiOBHm_Chr1g0317371 RchiOBHm_Chr1g0317421 RchiOBHm_Chr1g0317441 RchiOBHm_Chr1g0317501 RchiOBHm_Chr1g0317581 RchiOBHm_Chr1g0317591
rosa_laevigata RLG00000030523 RLG00000030595 RLG00000030598
rosa_multiflora Rmu_sc0001403.1_g000012 Rmu_sc0001403.1_g000037 Rmu_sc0003374.1_g000001 Rmu_sc0003374.1_g000006 Rmu_sc0009583.1_g000010
rosa_roxburghii Rroxscaffold_4G00330280 Rroxscaffold_4G00330300 Rroxscaffold_4G00330420 Rroxscaffold_4G00330450
rosa_rugosa Rorug01G0016100 Rorug01G0016200 Rorug01G0016200 Rorug01G0016300 Rorug01G0016400
rosa_samantha Rh1BG023400 Rh1BG023800 Rh1BG024400 Rh1DG044600 Rh1DG044900 Rh1DG045100 Rh1DG045200 Rh1DG045400 Rh1DG045600
rosa_wichuraiana Rw0G002050 Rw1G001940 Rw1G001950 Rw1G002000 Rw1G002030

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 6
AclWI GGATC 3 cut(s) 200, 383, 536
AcsI RAATTY 2 cut(s) 434, 614
AfaI GTAC 1 cut(s) 348
AgsI TTSAA 3 cut(s) 268, 565, 585
AjnI CCWGG 1 cut(s) 115
AluBI AGCT 4 cut(s) 38, 53, 122, 137
AluI AGCT 4 cut(s) 38, 53, 122, 137
AlwI GGATC 3 cut(s) 200, 383, 536
ApeKI GCWGC 3 cut(s) 476, 605, 682
ApoI RAATTY 2 cut(s) 434, 614
Asp700I GAANNNNTTC 1 cut(s) 255
AspS9I GGNCC 1 cut(s) 671
AsuHPI GGTGA 3 cut(s) 76, 160, 655
AvaII GGWCC 1 cut(s) 671
BbsI GAAGAC 1 cut(s) 502
BbvI GCAGC 3 cut(s) 463, 592, 694
BccI CCATC 4 cut(s) 233, 305, 661, 703
BciT130I CCWGG 1 cut(s) 117
BfmI CTRYAG 2 cut(s) 393, 477
BisI GCNGC 3 cut(s) 477, 606, 683
BlsI GCNGC 3 cut(s) 478, 607, 684
Bme1390I CCNGG 1 cut(s) 117
Bme18I GGWCC 1 cut(s) 671
BmgT120I GGNCC 1 cut(s) 671
BmiI GGNNCC 1 cut(s) 672
BmrFI CCNGG 1 cut(s) 117
BmsI GCATC 1 cut(s) 347
BpiI GAAGAC 1 cut(s) 502
BpuEI CTTGAG 1 cut(s) 707
Bsa29I ATCGAT 1 cut(s) 359
BsaJI CCNNGG 2 cut(s) 115, 471
BsaWI WCCGGW 1 cut(s) 343
BsaXI ACNNNNNCTCC 2 cut(s) 325, 355
BseBI CCWGG 1 cut(s) 117
BseCI ATCGAT 1 cut(s) 359
BseDI CCNNGG 2 cut(s) 115, 471
BseGI GGATG 1 cut(s) 320
BseRI GAGGAG 2 cut(s) 572, 614
BseXI GCAGC 3 cut(s) 463, 592, 694
BshVI ATCGAT 1 cut(s) 359
BsiSI CCGG 1 cut(s) 344
Bsp143I GATC 4 cut(s) 205, 360, 388, 541
Bsp19I CCATGG 1 cut(s) 471
BspACI CCGC 1 cut(s) 6
BspDI ATCGAT 1 cut(s) 359
BspLI GGNNCC 1 cut(s) 672
BspMAI CTGCAG 2 cut(s) 397, 481
BspPI GGATC 3 cut(s) 200, 383, 536
BssECI CCNNGG 2 cut(s) 115, 471
BssMI GATC 4 cut(s) 205, 360, 388, 541
BssT1I CCWWGG 1 cut(s) 471
Bst2UI CCWGG 1 cut(s) 117
Bst4CI ACNGT 3 cut(s) 106, 190, 703
Bst6I CTCTTC 1 cut(s) 279
BstDSI CCRYGG 1 cut(s) 471
BstEII GGTNACC 1 cut(s) 643
BstF5I GGATG 1 cut(s) 320
BstKTI GATC 4 cut(s) 208, 363, 391, 544
BstMBI GATC 4 cut(s) 205, 360, 388, 541
BstMWI GCNNNNNNNGC 1 cut(s) 602
BstNI CCWGG 1 cut(s) 117
BstPI GGTNACC 1 cut(s) 643
BstSCI CCNGG 1 cut(s) 115
BstSFI CTRYAG 2 cut(s) 393, 477
BstV1I GCAGC 3 cut(s) 463, 592, 694
BstV2I GAAGAC 1 cut(s) 502
Bsu15I ATCGAT 1 cut(s) 359
BsuTUI ATCGAT 1 cut(s) 359
BtgI CCRYGG 1 cut(s) 471
BtsCI GGATG 1 cut(s) 320
BtsIMutI CAGTG 2 cut(s) 370, 699
Cfr13I GGNCC 1 cut(s) 671
ClaI ATCGAT 1 cut(s) 359
Csp6I GTAC 1 cut(s) 347
CviAII CATG 7 cut(s) 57, 141, 426, 472, 531, 570, 640
CviQI GTAC 1 cut(s) 347
DpnI GATC 4 cut(s) 207, 362, 390, 543
DpnII GATC 4 cut(s) 205, 360, 388, 541
Eam1104I CTCTTC 1 cut(s) 279
EarI CTCTTC 1 cut(s) 279
EciI GGCGGA 1 cut(s) 21
Eco130I CCWWGG 1 cut(s) 471
Eco47I GGWCC 1 cut(s) 671
Eco91I GGTNACC 1 cut(s) 643
EcoO65I GGTNACC 1 cut(s) 643
EcoRII CCWGG 1 cut(s) 115
EcoT14I CCWWGG 1 cut(s) 471
ErhI CCWWGG 1 cut(s) 471
FaeI CATG 7 cut(s) 60, 144, 429, 475, 534, 573, 643
FatI CATG 7 cut(s) 56, 140, 425, 471, 530, 569, 639
Fnu4HI GCNGC 3 cut(s) 477, 606, 683
FokI GGATG 1 cut(s) 327
Fsp4HI GCNGC 3 cut(s) 477, 606, 683
GluI GCNGC 3 cut(s) 477, 606, 683
HapII CCGG 1 cut(s) 344
Hin1II CATG 7 cut(s) 60, 144, 429, 475, 534, 573, 643
HinfI GANTC 1 cut(s) 718
HpaII CCGG 1 cut(s) 344
HphI GGTGA 3 cut(s) 76, 160, 655
Hpy166II GTNNAC 1 cut(s) 674
Hpy188I TCNGA 2 cut(s) 541, 717
Hpy188III TCNNGA 4 cut(s) 110, 194, 448, 724
Hpy8I GTNNAC 1 cut(s) 674
HpyAV CCTTC 3 cut(s) 10, 314, 559
HpyCH4III ACNGT 3 cut(s) 106, 190, 703
HpyCH4V TGCA 3 cut(s) 395, 479, 682
HpyF10VI GCNNNNNNNGC 1 cut(s) 602
Hsp92II CATG 7 cut(s) 60, 144, 429, 475, 534, 573, 643
Kzo9I GATC 4 cut(s) 205, 360, 388, 541
LmnI GCTCC 3 cut(s) 35, 119, 242
Lsp1109I GCAGC 3 cut(s) 463, 592, 694
LweI GCATC 1 cut(s) 347
MaeIII GTNAC 7 cut(s) 28, 75, 110, 159, 194, 365, 643
MalI GATC 4 cut(s) 207, 362, 390, 543
MboI GATC 4 cut(s) 205, 360, 388, 541
MboII GAAGA 5 cut(s) 79, 163, 296, 459, 507
MluCI AATT 4 cut(s) 275, 434, 614, 694
MmeI TCCRAC 1 cut(s) 464
MnlI CCTC 9 cut(s) 6, 77, 161, 280, 444, 517, 550, 592, 595
MroXI GAANNNNTTC 1 cut(s) 255
MseI TTAA 5 cut(s) 411, 420, 461, 503, 693
MspI CCGG 1 cut(s) 344
MspR9I CCNGG 1 cut(s) 117
MvaI CCWGG 1 cut(s) 117
MwoI GCNNNNNNNGC 1 cut(s) 602
NcoI CCATGG 1 cut(s) 471
NdeII GATC 4 cut(s) 205, 360, 388, 541
NlaIII CATG 7 cut(s) 60, 144, 429, 475, 534, 573, 643
NlaIV GGNNCC 1 cut(s) 672
NmuCI GTSAC 4 cut(s) 110, 194, 365, 643
PdmI GAANNNNTTC 1 cut(s) 255
PfeI GAWTC 1 cut(s) 718
PkrI GCNGC 3 cut(s) 478, 607, 684
Psp6I CCWGG 1 cut(s) 115
PspEI GGTNACC 1 cut(s) 643
PspGI CCWGG 1 cut(s) 115
PspN4I GGNNCC 1 cut(s) 672
PspPI GGNCC 1 cut(s) 671
PstI CTGCAG 2 cut(s) 397, 481
RsaI GTAC 1 cut(s) 348
RsaNI GTAC 1 cut(s) 347
SaqAI TTAA 5 cut(s) 411, 420, 461, 503, 693
SatI GCNGC 3 cut(s) 477, 606, 683
Sau3AI GATC 4 cut(s) 205, 360, 388, 541
Sau96I GGNCC 1 cut(s) 671
ScrFI CCNGG 1 cut(s) 117
SfaNI GCATC 1 cut(s) 347
SfcI CTRYAG 2 cut(s) 393, 477
SinI GGWCC 1 cut(s) 671
SmlI CTYRAG 1 cut(s) 722
SmoI CTYRAG 1 cut(s) 722
Sse9I AATT 4 cut(s) 275, 434, 614, 694
SsiI CCGC 1 cut(s) 6
StyD4I CCNGG 1 cut(s) 115
StyI CCWWGG 1 cut(s) 471
TaaI ACNGT 3 cut(s) 106, 190, 703
TaqI TCGA 1 cut(s) 359
TasI AATT 4 cut(s) 275, 434, 614, 694
TfiI GAWTC 1 cut(s) 718
Tru1I TTAA 5 cut(s) 411, 420, 461, 503, 693
Tru9I TTAA 5 cut(s) 411, 420, 461, 503, 693
TscAI CASTG 2 cut(s) 370, 706
TseFI GTSAC 4 cut(s) 110, 194, 365, 643
TseI GCWGC 3 cut(s) 476, 605, 682
Tsp45I GTSAC 4 cut(s) 110, 194, 365, 643
TspDTI ATGAA 7 cut(s) 37, 45, 121, 129, 248, 345, 540
TspRI CASTG 2 cut(s) 370, 706
VpaK11BI GGWCC 1 cut(s) 671
XapI RAATTY 2 cut(s) 434, 614
XmnI GAANNNNTTC 1 cut(s) 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.