Rmu_sc0007650.1_g000006

NAD(P)H-binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007650.1
OG0000539
Physical Location & Seq
Forward (+)
27703 .. 30237
2535 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007650.1_g000006.1.cds

Sequence Viewer

Length: 978 bp
atgaactgcggagaaagcaaggttgtgtgtgtgacgggagcatctggttacatagcatcatggctggtgaagctcttgttgcaacgaggttatactgtcaaagccacggttcgggacccagacgatcaaaagaaaacagaacacctactctcacttgatggagcaaaggaaaggcttcatttgttcaaagcagacttgttagaagaagggtcttttgatacggcaattcatggatgtgaatgtcttttccatacggcgtcccctgtcctactctcagtctcatcaactaatccgcaggcagaattaattgaccctgctttgaagggaacgcttaatgtccttggatcttgtgtgaaggttcagtctatcaaaagggtggttataacatcctctatagcagcagttggatataatggaaaacctcttactgctgatgtaataatcgatgaatcttggttttcagatcctgctttttgtgaaaaaacaaagctttggtatatgctttcaaagacattagctgaggaagctgcttggaagtttgcaaaagagaaaggaattgatattattacaataaatccaggatgggtgatcggccctcttttacagccaactctgaactttagtgatgaaatagttctgaaactcgtaaatggaactgaaaagtttcccaacaaaacttacggatttgttgatgttagagatgttgctaatgcccatattctagcctttgaaaacctatcagctagtggacgttattgtttagttggaagcgtaaaacactgctccgaggttgtgaaaatgttgcacgagatctcccctgttctcaatcttccagataaatgtgcagatgacgagcctttctcaccgacttaccaggtgtccaaggaaagagcccaaactttgggggtaaaatatattccgcttgaagtgtctctgaaggatacagttgaaagtttgaaggacaagaacttcttctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Epimerase

Protein Analysis

325

Amino Acids

35.74

Weight (kDa)

5.86

Isoelectric Point (pI)

25.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000539)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G51410 AT5G19440
fragaria_vesca FvH4_3g28560 FvH4_3g28560 FvH4_3g28560 FvH4_7g01561 FvH4_7g01563 FvH4_7g01563 FvH4_7g01564 FvH4_7g01580 FvH4_7g01580 FvH4_7g01580 FvH4_7g05190
malus_domestica MD02G1302800.v1.1 MD02G1302900.v1.1 MD03G1172800.v1.1 MD07G1020700.v1.1 MD11G1190800.v1.1
prunus_persica Prupe.2G021600_v2.0.a1 Prupe.2G021600_v2.0.a1 Prupe.2G021600_v2.0.a1 Prupe.4G253700_v2.0.a1 Prupe.4G253700_v2.0.a1 Prupe.4G253700_v2.0.a1
pyrus_communis pycom02g25510 pycom02g25520 pycom11g16630
rosa_chinensis RchiOBHm_Chr1g0316841 RchiOBHm_Chr1g0317331 RchiOBHm_Chr1g0317461 RchiOBHm_Chr1g0317621 RchiOBHm_Chr1g0317661 RchiOBHm_Chr1g0317681 RchiOBHm_Chr1g0317691 RchiOBHm_Chr1g0317701 RchiOBHm_Chr5g0052741
rosa_laevigata RLG00000030526 RLG00000030589 RLG00000030590 RLG00000030591 RLG00000030605 RLG00000034802
rosa_multiflora Rmu_co8392933.1_g000001 Rmu_sc0001158.1_g000003 Rmu_sc0003816.1_g000002 Rmu_sc0007650.1_g000001 Rmu_sc0007650.1_g000006 Rmu_sc0010265.1_g000014 Rmu_sc0019879.1_g000002 Rmu_ssc0000324.1_g000001
rosa_roxburghii Rroxscaffold_1G00028520 Rroxscaffold_4G00330220 Rroxscaffold_4G00330240 Rroxscaffold_4G00330250 Rroxscaffold_4G00330260 Rroxscaffold_4G00330270 Rroxscaffold_4G00330310 Rroxscaffold_4G00330480
rosa_rugosa Rorug01G0016000 Rorug01G0016500 Rorug01G0016700 Rorug01G0016800 Rorug01G0023900 Rorug05G0270400 Rorug05G0270500
rosa_samantha Rh1BG024200 Rh1BG024800 Rh1BG024900 Rh1BG025000 Rh1DG044100 Rh1DG044200 Rh1DG044400 Rh1DG044500 Rh1DG044800 Rh1DG045800 Rh5CG379500 Rh5DG369300
rosa_wichuraiana Rw1G001920 Rw1G002020 Rw1G002040 Rw1G002060 Rw1G002070 Rw1G002080 Rw5G032270

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 383
AccB7I CCANNNNNTGG 1 cut(s) 901
AciI CCGC 3 cut(s) 9, 293, 920
AclWI GGATC 2 cut(s) 352, 458
AcuI CTGAAG 1 cut(s) 956
AcyI GRCGYC 1 cut(s) 257
AfiI CCNNNNNNNGG 2 cut(s) 111, 901
AgsI TTSAA 7 cut(s) 187, 322, 507, 731, 926, 950, 958
AjnI CCWGG 2 cut(s) 577, 873
AluBI AGCT 5 cut(s) 73, 490, 518, 527, 743
AluI AGCT 5 cut(s) 73, 490, 518, 527, 743
Alw26I GTCTC 2 cut(s) 283, 936
AlwI GGATC 2 cut(s) 352, 458
AlwNI CAGNNNCTG 1 cut(s) 467
AoxI GGCC 1 cut(s) 592
ApeKI GCWGC 2 cut(s) 398, 527
AseI ATTAAT 1 cut(s) 305
Asp700I GAANNNNTTC 4 cut(s) 174, 633, 663, 971
AspS9I GGNCC 2 cut(s) 115, 593
AsuHPI GGTGA 3 cut(s) 79, 598, 855
AvaII GGWCC 1 cut(s) 115
BanII GRGCYC 1 cut(s) 895
BauI CACGAG 1 cut(s) 806
BbvCI CCTCAGC 1 cut(s) 519
BbvI GCAGC 2 cut(s) 410, 514
BccI CCATC 2 cut(s) 152, 576
BceAI ACGGC 2 cut(s) 237, 270
BciT130I CCWGG 2 cut(s) 579, 875
BciVI GTATCC 1 cut(s) 934
BcoDI GTCTC 2 cut(s) 283, 936
BfaI CTAG 2 cut(s) 722, 744
BfmI CTRYAG 1 cut(s) 393
BfuI GTATCC 1 cut(s) 934
BglII AGATCT 1 cut(s) 810
BisI GCNGC 2 cut(s) 399, 528
BlsI GCNGC 2 cut(s) 400, 529
Bme1390I CCNGG 2 cut(s) 579, 875
Bme18I GGWCC 1 cut(s) 115
BmgT120I GGNCC 2 cut(s) 115, 593
BmiI GGNNCC 2 cut(s) 116, 117
BmrFI CCNGG 2 cut(s) 579, 875
BmsI GCATC 2 cut(s) 50, 65
BplI GAGNNNNNCTC 2 cut(s) 845, 877
Bpu10I CCTNAGC 1 cut(s) 519
Bsa29I ATCGAT 1 cut(s) 444
BsaHI GRCGYC 1 cut(s) 257
BsaJI CCNNGG 4 cut(s) 105, 340, 786, 882
BsaXI ACNNNNNCTCC 2 cut(s) 797, 827
Bsc4I CCNNNNNNNGG 2 cut(s) 111, 901
BseBI CCWGG 2 cut(s) 579, 875
BseCI ATCGAT 1 cut(s) 444
BseDI CCNNGG 4 cut(s) 105, 340, 786, 882
BseGI GGATG 3 cut(s) 239, 386, 587
BseLI CCNNNNNNNGG 2 cut(s) 111, 901
BseMII CTCAG 2 cut(s) 288, 510
BseXI GCAGC 2 cut(s) 410, 514
BsgI GTGCAG 1 cut(s) 864
BshFI GGCC 1 cut(s) 594
BshVI ATCGAT 1 cut(s) 444
BslFI GGGAC 2 cut(s) 128, 244
BslI CCNNNNNNNGG 2 cut(s) 111, 901
BsmAI GTCTC 2 cut(s) 283, 936
BsmFI GGGAC 2 cut(s) 128, 244
BsnI GGCC 1 cut(s) 594
Bsp1286I GDGCHC 1 cut(s) 895
Bsp143I GATC 5 cut(s) 124, 344, 463, 588, 810
BspACI CCGC 3 cut(s) 9, 293, 920
BspANI GGCC 1 cut(s) 594
BspCNI CTCAG 2 cut(s) 287, 511
BspDI ATCGAT 1 cut(s) 444
BspLI GGNNCC 2 cut(s) 116, 117
BspPI GGATC 2 cut(s) 352, 458
BssECI CCNNGG 4 cut(s) 105, 340, 786, 882
BssMI GATC 5 cut(s) 124, 344, 463, 588, 810
BssNI GRCGYC 1 cut(s) 257
BssSI CACGAG 1 cut(s) 806
BssT1I CCWWGG 2 cut(s) 340, 882
Bst2BI CACGAG 1 cut(s) 806
Bst2UI CCWGG 2 cut(s) 579, 875
Bst4CI ACNGT 3 cut(s) 97, 109, 946
BstACI GRCGYC 1 cut(s) 257
BstC8I GCNNGC 1 cut(s) 297
BstDEI CTNAG 2 cut(s) 274, 519
BstDSI CCRYGG 1 cut(s) 105
BstF5I GGATG 3 cut(s) 239, 386, 587
BstKTI GATC 5 cut(s) 127, 347, 466, 591, 813
BstMAI GTCTC 2 cut(s) 283, 936
BstMBI GATC 5 cut(s) 124, 344, 463, 588, 810
BstMWI GCNNNNNNNGC 4 cut(s) 15, 70, 79, 524
BstNI CCWGG 2 cut(s) 579, 875
BstSCI CCNGG 2 cut(s) 577, 873
BstSFI CTRYAG 1 cut(s) 393
BstV1I GCAGC 2 cut(s) 410, 514
BstX2I RGATCY 3 cut(s) 344, 463, 810
BstYI RGATCY 3 cut(s) 344, 463, 810
Bsu15I ATCGAT 1 cut(s) 444
BsuI GTATCC 1 cut(s) 934
BsuRI GGCC 1 cut(s) 594
BsuTUI ATCGAT 1 cut(s) 444
BtgI CCRYGG 1 cut(s) 105
BtsCI GGATG 3 cut(s) 239, 386, 587
BtsI GCAGTG 1 cut(s) 778
BtsIMutI CAGTG 1 cut(s) 778
Cac8I GCNNGC 1 cut(s) 297
CaiI CAGNNNCTG 1 cut(s) 467
Cfr13I GGNCC 2 cut(s) 115, 593
ClaI ATCGAT 1 cut(s) 444
CseI GACGC 1 cut(s) 246
CsiI ACCWGGT 1 cut(s) 873
CviAII CATG 2 cut(s) 60, 230
DdeI CTNAG 2 cut(s) 274, 519
DpnI GATC 5 cut(s) 126, 346, 465, 590, 812
DpnII GATC 5 cut(s) 124, 344, 463, 588, 810
Eco130I CCWWGG 2 cut(s) 340, 882
Eco24I GRGCYC 1 cut(s) 895
Eco47I GGWCC 1 cut(s) 115
Eco57I CTGAAG 1 cut(s) 956
EcoO109I RGGNCCY 1 cut(s) 115
EcoRII CCWGG 2 cut(s) 577, 873
EcoT14I CCWWGG 2 cut(s) 340, 882
EcoT38I GRGCYC 1 cut(s) 895
ErhI CCWWGG 2 cut(s) 340, 882
FaeI CATG 2 cut(s) 63, 233
FalI AAGNNNNNCTT 1 cut(s) 956
FaqI GGGAC 2 cut(s) 128, 244
FatI CATG 2 cut(s) 59, 229
Fnu4HI GCNGC 2 cut(s) 399, 528
FokI GGATG 3 cut(s) 246, 373, 594
FriOI GRGCYC 1 cut(s) 895
Fsp4HI GCNGC 2 cut(s) 399, 528
FspBI CTAG 2 cut(s) 722, 744
GluI GCNGC 2 cut(s) 399, 528
HaeIII GGCC 1 cut(s) 594
HgaI GACGC 1 cut(s) 246
Hin1I GRCGYC 1 cut(s) 257
Hin1II CATG 2 cut(s) 63, 233
HindIII AAGCTT 1 cut(s) 488
HinfI GANTC 1 cut(s) 449
HphI GGTGA 3 cut(s) 79, 598, 855
Hpy166II GTNNAC 1 cut(s) 749
Hpy188I TCNGA 5 cut(s) 463, 615, 639, 787, 936
Hpy188III TCNNGA 2 cut(s) 113, 833
Hpy8I GTNNAC 1 cut(s) 749
HpyAV CCTTC 5 cut(s) 200, 316, 349, 931, 952
HpyCH4III ACNGT 3 cut(s) 97, 109, 946
HpyCH4IV ACGT 1 cut(s) 751
HpyCH4V TGCA 4 cut(s) 82, 542, 805, 845
HpyF10VI GCNNNNNNNGC 4 cut(s) 15, 70, 79, 524
HpyF3I CTNAG 2 cut(s) 274, 519
HpySE526I ACGT 1 cut(s) 751
Hsp92I GRCGYC 1 cut(s) 257
Hsp92II CATG 2 cut(s) 63, 233
KflI GGGWCCC 1 cut(s) 115
Kzo9I GATC 5 cut(s) 124, 344, 463, 588, 810
LmnI GCTCC 3 cut(s) 38, 161, 788
Lsp1109I GCAGC 2 cut(s) 410, 514
LweI GCATC 2 cut(s) 50, 65
MabI ACCWGGT 1 cut(s) 873
MaeI CTAG 2 cut(s) 722, 744
MaeII ACGT 1 cut(s) 751
MaeIII GTNAC 2 cut(s) 31, 47
MalI GATC 5 cut(s) 126, 346, 465, 590, 812
MboI GATC 5 cut(s) 124, 344, 463, 588, 810
MboII GAAGA 3 cut(s) 215, 821, 964
MflI RGATCY 3 cut(s) 344, 463, 810
MhlI GDGCHC 1 cut(s) 895
MluCI AATT 4 cut(s) 225, 302, 306, 555
MmeI TCCRAC 2 cut(s) 385, 745
MnlI CCTC 6 cut(s) 80, 400, 432, 514, 606, 781
MroXI GAANNNNTTC 4 cut(s) 174, 633, 663, 971
MseI TTAA 2 cut(s) 305, 333
MslI CAYNNNNRTG 1 cut(s) 234
MspR9I CCNGG 2 cut(s) 579, 875
MvaI CCWGG 2 cut(s) 579, 875
MwoI GCNNNNNNNGC 4 cut(s) 15, 70, 79, 524
NdeII GATC 5 cut(s) 124, 344, 463, 588, 810
NlaIII CATG 2 cut(s) 63, 233
NlaIV GGNNCC 2 cut(s) 116, 117
NmuCI GTSAC 1 cut(s) 31
PdmI GAANNNNTTC 4 cut(s) 174, 633, 663, 971
PfeI GAWTC 1 cut(s) 449
PflMI CCANNNNNTGG 1 cut(s) 901
PfoI TCCNGGA 1 cut(s) 577
PkrI GCNGC 2 cut(s) 400, 529
PpuMI RGGWCCY 1 cut(s) 115
PshBI ATTAAT 1 cut(s) 305
PsiI TTATAA 1 cut(s) 383
Psp5II RGGWCCY 1 cut(s) 115
Psp6I CCWGG 2 cut(s) 577, 873
PspGI CCWGG 2 cut(s) 577, 873
PspN4I GGNNCC 2 cut(s) 116, 117
PspPI GGNCC 2 cut(s) 115, 593
PspPPI RGGWCCY 1 cut(s) 115
PstNI CAGNNNCTG 1 cut(s) 467
PsuI RGATCY 3 cut(s) 344, 463, 810
RseI CAYNNNNRTG 1 cut(s) 234
SaqAI TTAA 2 cut(s) 305, 333
SatI GCNGC 2 cut(s) 399, 528
Sau3AI GATC 5 cut(s) 124, 344, 463, 588, 810
Sau96I GGNCC 2 cut(s) 115, 593
ScrFI CCNGG 2 cut(s) 579, 875
SduI GDGCHC 1 cut(s) 895
SexAI ACCWGGT 1 cut(s) 873
SfaNI GCATC 2 cut(s) 50, 65
SfcI CTRYAG 1 cut(s) 393
SinI GGWCC 1 cut(s) 115
SmiMI CAYNNNNRTG 1 cut(s) 234
Sse9I AATT 4 cut(s) 225, 302, 306, 555
SsiI CCGC 3 cut(s) 9, 293, 920
SspMI CTAG 2 cut(s) 722, 744
StyD4I CCNGG 2 cut(s) 577, 873
StyI CCWWGG 2 cut(s) 340, 882
TaaI ACNGT 3 cut(s) 97, 109, 946
TaiI ACGT 1 cut(s) 754
TaqI TCGA 1 cut(s) 444
TasI AATT 4 cut(s) 225, 302, 306, 555
TfiI GAWTC 1 cut(s) 449
Tru1I TTAA 2 cut(s) 305, 333
Tru9I TTAA 2 cut(s) 305, 333
TscAI CASTG 1 cut(s) 785
TseFI GTSAC 1 cut(s) 31
TseI GCWGC 2 cut(s) 398, 527
Tsp45I GTSAC 1 cut(s) 31
TspDTI ATGAA 5 cut(s) 17, 167, 218, 462, 642
TspGWI ACGGA 1 cut(s) 696
TspRI CASTG 1 cut(s) 785
Van91I CCANNNNNTGG 1 cut(s) 901
VpaK11BI GGWCC 1 cut(s) 115
VspI ATTAAT 1 cut(s) 305
XmnI GAANNNNTTC 4 cut(s) 174, 633, 663, 971
XspI CTAG 2 cut(s) 722, 744
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.