Rroxscaffold_1G00057370

UDP-glucose flavonoid 3-O-glucosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
79333006 .. 79358607
25602 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00057370.1

Sequence Viewer

Length: 168 bp
ATGGCGGAGGAGGTGGAGAGAAGCATAAAGAGCTTGATGGACGGTGATCATGTGGTGAGGGCTAGGGTGACAGACATGAGAGAGAAGAGTAGGGGAGCATTGATGGAAAATGGGTCTGCATACAAAGCACTAGAAGGTTTAATTGAGGAGCTAATGCCCAAGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.19

Weight (kDa)

5.29

Isoelectric Point (pI)

39.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000209)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G21760 AT3G21780 AT3G21790 AT3G21800 AT4G15260 AT4G15270 AT4G15270 AT4G15270 AT4G15280 AT4G15280
fragaria_vesca FvH4_3g10810 FvH4_6g39330 FvH4_6g39350 FvH4_6g39380 FvH4_6g39401 FvH4_6g39410 FvH4_6g39430
malus_domestica MD09G1140700.v1.1 MD09G1141100.v1.1 MD09G1141200.v1.1 MD09G1141300.v1.1 MD09G1141500.v1.1 MD09G1141600.v1.1 MD09G1141700.v1.1 MD09G1141800.v1.1 MD17G1129500.v1.1 MD17G1129700.v1.1
prunus_persica Prupe.3G184600_v2.0.a1 Prupe.3G184700_v2.0.a1 Prupe.3G184800_v2.0.a1 Prupe.3G184800_v2.0.a1 Prupe.3G184900_v2.0.a1 Prupe.3G185000_v2.0.a1 Prupe.3G185100_v2.0.a1 Prupe.3G185200_v2.0.a1 Prupe.7G013100_v2.0.a1
pyrus_communis pycom09g06130 pycom09g06140 pycom09g06170 pycom09g06180 pycom09g06200 pycom17g12200 pycom17g12230
rosa_chinensis RchiOBHm_Chr1g0339921 RchiOBHm_Chr1g0339941 RchiOBHm_Chr1g0339951 RchiOBHm_Chr1g0339981 RchiOBHm_Chr1g0340051 RchiOBHm_Chr1g0340061 RchiOBHm_Chr2g0153251 RchiOBHm_Chr2g0153261 RchiOBHm_Chr2g0153271 RchiOBHm_Chr2g0153291 RchiOBHm_Chr2g0153321 RchiOBHm_Chr2g0153381 RchiOBHm_Chr2g0153451 RchiOBHm_Chr2g0153461 RchiOBHm_Chr2g0153471
rosa_laevigata RLG00000013864 RLG00000020668 RLG00000020669 RLG00000020688 RLG00000020689 RLG00000020691 RLG00000020692 RLG00000020694 RLG00000020695 RLG00000020696 RLG00000020697 RLG00000020698 RLG00000029250 RLG00000029251 RLG00000029254 RLG00000029256 RLG00000029257
rosa_multiflora Rmu_co8175810.1_g000001 Rmu_co8338271.1_g000001 Rmu_co8340327.1_g000001 Rmu_sc0000160.1_g000002 Rmu_sc0000160.1_g000005 Rmu_sc0000160.1_g000017 Rmu_sc0000234.1_g000001 Rmu_sc0000234.1_g000002 Rmu_sc0000234.1_g000010 Rmu_sc0000442.1_g000011 Rmu_sc0000442.1_g000013 Rmu_sc0000442.1_g000014 Rmu_sc0003810.1_g000001 Rmu_sc0003810.1_g000004 Rmu_sc0004856.1_g000012 Rmu_sc0004856.1_g000013 Rmu_sc0004856.1_g000014 Rmu_sc0004856.1_g000016 Rmu_sc0007649.1_g000007 Rmu_sc0007649.1_g000008 Rmu_sc0007649.1_g000011 Rmu_sc0018149.1_g000001 Rmu_sc0034645.1_g000001 Rmu_sc0034646.1_g000001
rosa_roxburghii Rroxscaffold_1G00057370 Rroxscaffold_2G00095010 Rroxscaffold_2G00095020 Rroxscaffold_2G00095030 Rroxscaffold_2G00095050 Rroxscaffold_2G00095070 Rroxscaffold_4G00313800 Rroxscaffold_4G00313810 Rroxscaffold_4G00313820 Rroxscaffold_4G00313840 Rroxscaffold_4G00313900 Rroxscaffold_4G00313910
rosa_rugosa Rorug01G0137300.1 Rorug01G0137500.1 Rorug01G0137700.1 Rorug01G0137800.1 Rorug01G0138000.1 Rorug01G0138300.1 Rorug02G0437700.1 Rorug02G0437800 Rorug02G0437900 Rorug02G0437900 Rorug02G0437900 Rorug02G0438000 Rorug02G0438000 Rorug02G0438100 Rorug02G0438200
rosa_samantha Rh2AG500800 Rh2AG501000 Rh2AG501100 Rh2AG501200 Rh2AG501300 Rh2AG502000 Rh2AG502100 Rh2AG502200 Rh2BG512300 Rh2BG512500 Rh2CG487200 Rh2CG487300 Rh2CG487400 Rh2CG487900 Rh2CG488000 Rh2CG488100
rosa_wichuraiana Rw0G022390 Rw1G012850 Rw1G012860 Rw2G041100 Rw2G041120 Rw2G041130 Rw2G041140 Rw2G041150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AluBI AGCT 2 cut(s) 33, 151
AluI AGCT 2 cut(s) 33, 151
AsuHPI GGTGA 3 cut(s) 56, 67, 79
BccI CCATC 2 cut(s) 31, 97
BclI TGATCA 1 cut(s) 46
BfaI CTAG 2 cut(s) 63, 131
BseRI GAGGAG 2 cut(s) 23, 161
Bsp143I GATC 1 cut(s) 46
BspACI CCGC 1 cut(s) 5
BssMI GATC 1 cut(s) 46
Bst4CI ACNGT 1 cut(s) 44
Bst6I CTCTTC 1 cut(s) 80
BstKTI GATC 1 cut(s) 49
BstMBI GATC 1 cut(s) 46
BstMWI GCNNNNNNNGC 2 cut(s) 30, 125
CviAII CATG 2 cut(s) 50, 76
CviJI RGCY 3 cut(s) 33, 62, 151
CviKI_1 RGCY 3 cut(s) 33, 62, 151
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
Eam1104I CTCTTC 1 cut(s) 80
EarI CTCTTC 1 cut(s) 80
EciI GGCGGA 1 cut(s) 20
FaeI CATG 2 cut(s) 53, 79
FaiI YATR 4 cut(s) 26, 51, 77, 121
FatI CATG 2 cut(s) 49, 75
FbaI TGATCA 1 cut(s) 46
FspBI CTAG 2 cut(s) 63, 131
Hin1II CATG 2 cut(s) 53, 79
HphI GGTGA 3 cut(s) 56, 67, 79
HpyAV CCTTC 1 cut(s) 128
HpyCH4III ACNGT 1 cut(s) 44
HpyCH4V TGCA 1 cut(s) 119
HpyF10VI GCNNNNNNNGC 2 cut(s) 30, 125
Hsp92II CATG 2 cut(s) 53, 79
Ksp22I TGATCA 1 cut(s) 46
Kzo9I GATC 1 cut(s) 46
LmnI GCTCC 2 cut(s) 95, 148
MaeI CTAG 2 cut(s) 63, 131
MaeIII GTNAC 1 cut(s) 67
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MboII GAAGA 1 cut(s) 97
MluCI AATT 1 cut(s) 141
MnlI CCTC 3 cut(s) 4, 51, 139
MseI TTAA 1 cut(s) 140
MwoI GCNNNNNNNGC 2 cut(s) 30, 125
NdeII GATC 1 cut(s) 46
NlaIII CATG 2 cut(s) 53, 79
NmuCI GTSAC 1 cut(s) 67
SaqAI TTAA 1 cut(s) 140
Sau3AI GATC 1 cut(s) 46
SetI ASST 4 cut(s) 15, 35, 139, 153
SgeI CNNG 5 cut(s) 46, 62, 75, 88, 143
Sse9I AATT 1 cut(s) 141
SsiI CCGC 1 cut(s) 5
SspMI CTAG 2 cut(s) 63, 131
TaaI ACNGT 1 cut(s) 44
TasI AATT 1 cut(s) 141
Tru1I TTAA 1 cut(s) 140
Tru9I TTAA 1 cut(s) 140
TseFI GTSAC 1 cut(s) 67
Tsp45I GTSAC 1 cut(s) 67
XspI CTAG 2 cut(s) 63, 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.