Rh3CG311800

Phospho-2-dehydro-3-deoxyheptonate aldolase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
32828524 .. 32829756
1233 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG311800.1

Sequence Viewer

Length: 186 bp
ATGCTTTGGTGCGGGGAGCATACCCGTCAACTGGATGGTGCGCATTATGAGTTCCTAAGGGGAATCTCCAACCTCGTTGGAGTCAAGGATGCCAAAAATTATGGGCGCGAAGTGAATGACAAAGTTGATTTCAACTGGAAGAAACTTTTGCAGAAAAAGGCTATGCCTCTTTCTTTTTATTACTAG

Protein Analysis

61

Amino Acids

7.22

Weight (kDa)

9.17

Isoelectric Point (pI)

23.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DAHP_synth_2 PF01474 1 - 33 3.2e-09 Class-II DAHP synthetase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 42
AccII CGCG 1 cut(s) 108
AciI CCGC 1 cut(s) 12
AfiI CCNNNNNNNGG 1 cut(s) 31
AgsI TTSAA 1 cut(s) 133
AspLEI GCGC 2 cut(s) 43, 108
AxyI CCTNAGG 1 cut(s) 56
BccI CCATC 1 cut(s) 29
BfaI CTAG 1 cut(s) 184
BmsI GCATC 1 cut(s) 79
Bsc4I CCNNNNNNNGG 1 cut(s) 31
Bse1I ACTGG 2 cut(s) 36, 140
Bse21I CCTNAGG 1 cut(s) 56
BseGI GGATG 2 cut(s) 40, 94
BseLI CCNNNNNNNGG 1 cut(s) 31
BseNI ACTGG 2 cut(s) 36, 140
Bsh1236I CGCG 1 cut(s) 108
BslI CCNNNNNNNGG 1 cut(s) 31
BspACI CCGC 1 cut(s) 12
BspFNI CGCG 1 cut(s) 108
BsrI ACTGG 2 cut(s) 36, 140
BstDEI CTNAG 1 cut(s) 56
BstF5I GGATG 2 cut(s) 40, 94
BstFNI CGCG 1 cut(s) 108
BstHHI GCGC 2 cut(s) 43, 108
BstUI CGCG 1 cut(s) 108
Bsu36I CCTNAGG 1 cut(s) 56
BtsCI GGATG 2 cut(s) 40, 94
CfoI GCGC 2 cut(s) 43, 108
CviJI RGCY 1 cut(s) 161
CviKI_1 RGCY 1 cut(s) 161
DdeI CTNAG 1 cut(s) 56
Eco81I CCTNAGG 1 cut(s) 56
FaiI YATR 4 cut(s) 21, 48, 102, 164
FauI CCCGC 1 cut(s) 5
FokI GGATG 2 cut(s) 47, 101
FspAI RTGCGCAY 1 cut(s) 42
FspBI CTAG 1 cut(s) 184
FspI TGCGCA 1 cut(s) 42
GlaI GCGC 2 cut(s) 42, 107
HhaI GCGC 2 cut(s) 43, 108
Hin6I GCGC 2 cut(s) 41, 106
HinP1I GCGC 2 cut(s) 41, 106
HincII GTYRAC 1 cut(s) 29
HindII GTYRAC 1 cut(s) 29
HinfI GANTC 2 cut(s) 63, 81
Hpy166II GTNNAC 1 cut(s) 29
Hpy8I GTNNAC 1 cut(s) 29
HpyCH4V TGCA 1 cut(s) 151
HpyF3I CTNAG 1 cut(s) 56
HspAI GCGC 2 cut(s) 41, 106
LmnI GCTCC 1 cut(s) 16
LpnPI CCDG 2 cut(s) 17, 121
LweI GCATC 1 cut(s) 79
MaeI CTAG 1 cut(s) 184
MboII GAAGA 1 cut(s) 151
MluCI AATT 1 cut(s) 97
MlyI GAGTC 1 cut(s) 90
MmeI TCCRAC 2 cut(s) 58, 93
MnlI CCTC 2 cut(s) 83, 177
MvnI CGCG 1 cut(s) 108
NsbI TGCGCA 1 cut(s) 42
PfeI GAWTC 1 cut(s) 63
PleI GAGTC 1 cut(s) 89
PpsI GAGTC 1 cut(s) 89
SchI GAGTC 1 cut(s) 90
SetI ASST 1 cut(s) 75
SfaNI GCATC 1 cut(s) 79
SgeI CNNG 7 cut(s) 25, 36, 44, 86, 97, 119, 148
Sse9I AATT 1 cut(s) 97
SsiI CCGC 1 cut(s) 12
SspMI CTAG 1 cut(s) 184
TasI AATT 1 cut(s) 97
TfiI GAWTC 1 cut(s) 63
XspI CTAG 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.