AT2G24870

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
OG0000986
Physical Location & Seq
Reverse (-)
10588569 .. 10589615
1047 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G24870.1

Sequence Viewer

Length: 168 bp
ATGGATCAAGCTTGGATAATCTCACAGAAATTTACAGCATTCAAGCTTTCTGGTTTTATGGATGAAGGAGGTATATGGGACTGGAGAGCAAGAGAAGATGGAATCTATTTAGACAAAGAAGGCGGCAAACATATTGGAAAATCGATTAATATGCATAAAAGTGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.33

Weight (kDa)

6.71

Isoelectric Point (pI)

32.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 123
AclWI GGATC 1 cut(s) 12
AcsI RAATTY 1 cut(s) 29
AgsI TTSAA 1 cut(s) 43
AluBI AGCT 2 cut(s) 11, 46
AluI AGCT 2 cut(s) 11, 46
AlwI GGATC 1 cut(s) 12
ApoI RAATTY 1 cut(s) 29
AseI ATTAAT 1 cut(s) 147
BccI CCATC 1 cut(s) 92
BcgI CGANNNNNNTGC 2 cut(s) 133, 167
BisI GCNGC 1 cut(s) 124
BlsI GCNGC 1 cut(s) 125
BpmI CTGGAG 1 cut(s) 103
Bsa29I ATCGAT 1 cut(s) 143
Bse1I ACTGG 1 cut(s) 86
BseCI ATCGAT 1 cut(s) 143
BseGI GGATG 1 cut(s) 67
BseNI ACTGG 1 cut(s) 86
BshVI ATCGAT 1 cut(s) 143
BslFI GGGAC 1 cut(s) 92
BsmFI GGGAC 1 cut(s) 92
BsmI GAATGC 1 cut(s) 38
Bsp143I GATC 1 cut(s) 4
BspACI CCGC 1 cut(s) 123
BspDI ATCGAT 1 cut(s) 143
BspPI GGATC 1 cut(s) 12
BsrI ACTGG 1 cut(s) 86
BssMI GATC 1 cut(s) 4
BstF5I GGATG 1 cut(s) 67
BstKTI GATC 1 cut(s) 7
BstMBI GATC 1 cut(s) 4
Bsu15I ATCGAT 1 cut(s) 143
BsuTUI ATCGAT 1 cut(s) 143
BtsCI GGATG 1 cut(s) 67
ClaI ATCGAT 1 cut(s) 143
CviJI RGCY 2 cut(s) 11, 46
CviKI_1 RGCY 2 cut(s) 11, 46
DpnI GATC 1 cut(s) 6
DpnII GATC 1 cut(s) 4
EcoT22I ATGCAT 1 cut(s) 156
FaiI YATR 7 cut(s) 59, 74, 76, 132, 152, 156, 166
FaqI GGGAC 1 cut(s) 92
Fnu4HI GCNGC 1 cut(s) 124
FokI GGATG 1 cut(s) 74
Fsp4HI GCNGC 1 cut(s) 124
GluI GCNGC 1 cut(s) 124
GsuI CTGGAG 1 cut(s) 103
HindIII AAGCTT 2 cut(s) 9, 44
HinfI GANTC 1 cut(s) 102
HpyAV CCTTC 2 cut(s) 59, 113
HpyCH4V TGCA 1 cut(s) 154
Kzo9I GATC 1 cut(s) 4
LpnPI CCDG 2 cut(s) 36, 67
MalI GATC 1 cut(s) 6
MboI GATC 1 cut(s) 4
MboII GAAGA 1 cut(s) 107
MluCI AATT 1 cut(s) 29
MnlI CCTC 1 cut(s) 62
Mph1103I ATGCAT 1 cut(s) 156
MseI TTAA 1 cut(s) 147
MslI CAYNNNNRTG 1 cut(s) 159
Mva1269I GAATGC 1 cut(s) 38
NdeII GATC 1 cut(s) 4
NsiI ATGCAT 1 cut(s) 156
PctI GAATGC 1 cut(s) 38
PfeI GAWTC 1 cut(s) 102
PkrI GCNGC 1 cut(s) 125
PshBI ATTAAT 1 cut(s) 147
RseI CAYNNNNRTG 1 cut(s) 159
SaqAI TTAA 1 cut(s) 147
SatI GCNGC 1 cut(s) 124
Sau3AI GATC 1 cut(s) 4
SetI ASST 3 cut(s) 13, 48, 73
SgeI CNNG 6 cut(s) 20, 24, 55, 63, 94, 102
SmiMI CAYNNNNRTG 1 cut(s) 159
Sse9I AATT 1 cut(s) 29
SsiI CCGC 1 cut(s) 123
TaqI TCGA 1 cut(s) 143
TasI AATT 1 cut(s) 29
TauI GCSGC 1 cut(s) 126
TfiI GAWTC 1 cut(s) 102
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TspDTI ATGAA 1 cut(s) 78
VspI ATTAAT 1 cut(s) 147
XapI RAATTY 1 cut(s) 29
Zsp2I ATGCAT 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.