AT5G04350

pumilio homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0000986
Physical Location & Seq
Forward (+)
1220829 .. 1221269
441 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G04350.1

Sequence Viewer

Length: 441 bp
ATGAACAATCTCTTCATATTTTCGATTGTTATTGGCTTATGCATTGGCGTAAGCAATGCTTTTCACGAGATAGGAGAAAGCAAAGTCGTGTTAAGCAATCAATTGGAACACAGCAAACTCCTCAAAGTTCATTGTCGTTCCAAAGACGACGATCTTGGGGAGCATATTTTGAAAATTGGCCAAGACTACGAGTTTACTTTTGGTGATAACATTTGGCAAACGACTAGTTTCTCATGTCAAATGGATCAGGGTCCTAATTTTAAGCATCACCTAGATTTTGTGGCATATGAGACTTCGTGGAGCAAAGCTCTTGAAGCTTCGTGTAAGTGGATAGGTAGAGAAGATGGAATCTATTTTTCTCAAGATGGAGTTCCTCCCACCAAAAAGTACCAAGATGGAGTTCCTCCCACCAAAAAGTACCAATGGGATGATCCTCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

146

Amino Acids

16.71

Weight (kDa)

5.56

Isoelectric Point (pI)

28.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 28 - 130 1.1e-29 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 252, 425
AcoI YGGCCR 1 cut(s) 178
AfaI GTAC 2 cut(s) 389, 419
AgsI TTSAA 2 cut(s) 172, 314
AhlI ACTAGT 1 cut(s) 224
AjuI GAANNNNNNNTTGG 2 cut(s) 384, 416
AluBI AGCT 2 cut(s) 308, 317
AluI AGCT 2 cut(s) 308, 317
Alw26I GTCTC 1 cut(s) 284
AlwI GGATC 2 cut(s) 252, 425
AoxI GGCC 1 cut(s) 178
AspS9I GGNCC 1 cut(s) 251
AsuHPI GGTGA 2 cut(s) 215, 260
AvaII GGWCC 1 cut(s) 251
BalI TGGCCA 1 cut(s) 180
BauI CACGAG 1 cut(s) 65
BccI CCATC 3 cut(s) 338, 359, 389
BcoDI GTCTC 1 cut(s) 284
BcuI ACTAGT 1 cut(s) 224
BfaI CTAG 2 cut(s) 225, 272
Bme18I GGWCC 1 cut(s) 251
BmgT120I GGNCC 1 cut(s) 251
BmiI GGNNCC 1 cut(s) 252
BmsI GCATC 1 cut(s) 274
BplI GAGNNNNNCTC 2 cut(s) 292, 324
BpuEI CTTGAG 1 cut(s) 345
Bse3DI GCAATG 1 cut(s) 61
BseGI GGATG 1 cut(s) 433
BseMI GCAATG 1 cut(s) 61
BseRI GAGGAG 1 cut(s) 110
BshFI GGCC 1 cut(s) 180
BsmAI GTCTC 1 cut(s) 284
BsnI GGCC 1 cut(s) 180
Bsp143I GATC 3 cut(s) 151, 244, 430
BspANI GGCC 1 cut(s) 180
BspLI GGNNCC 1 cut(s) 252
BspPI GGATC 2 cut(s) 252, 425
BsrDI GCAATG 1 cut(s) 61
BssMI GATC 3 cut(s) 151, 244, 430
BssSI CACGAG 1 cut(s) 65
Bst2BI CACGAG 1 cut(s) 65
Bst6I CTCTTC 1 cut(s) 17
BstF5I GGATG 1 cut(s) 433
BstKTI GATC 3 cut(s) 154, 247, 433
BstMAI GTCTC 1 cut(s) 284
BstMBI GATC 3 cut(s) 151, 244, 430
BstMWI GCNNNNNNNGC 1 cut(s) 314
BsuRI GGCC 1 cut(s) 180
BtsCI GGATG 1 cut(s) 433
Cfr13I GGNCC 1 cut(s) 251
Csp6I GTAC 2 cut(s) 388, 418
CviAII CATG 1 cut(s) 234
CviJI RGCY 4 cut(s) 36, 180, 308, 317
CviKI_1 RGCY 4 cut(s) 36, 180, 308, 317
CviQI GTAC 2 cut(s) 388, 418
DpnI GATC 3 cut(s) 153, 246, 432
DpnII GATC 3 cut(s) 151, 244, 430
EaeI YGGCCR 1 cut(s) 178
Eam1104I CTCTTC 1 cut(s) 17
EarI CTCTTC 1 cut(s) 17
Eco47I GGWCC 1 cut(s) 251
EcoO109I RGGNCCY 1 cut(s) 251
EcoT22I ATGCAT 1 cut(s) 44
FaeI CATG 1 cut(s) 237
FaiI YATR 6 cut(s) 17, 40, 165, 235, 286, 288
FalI AAGNNNNNCTT 2 cut(s) 43, 75
FatI CATG 1 cut(s) 233
FauNDI CATATG 1 cut(s) 286
FspBI CTAG 2 cut(s) 225, 272
HaeIII GGCC 1 cut(s) 180
Hin1II CATG 1 cut(s) 237
HindIII AAGCTT 1 cut(s) 315
HinfI GANTC 1 cut(s) 348
HphI GGTGA 2 cut(s) 215, 260
Hpy166II GTNNAC 1 cut(s) 195
Hpy188III TCNNGA 3 cut(s) 65, 311, 362
Hpy8I GTNNAC 1 cut(s) 195
Hpy99I CGWCG 1 cut(s) 152
HpyCH4V TGCA 1 cut(s) 42
HpyF10VI GCNNNNNNNGC 1 cut(s) 314
Hsp92II CATG 1 cut(s) 237
Kzo9I GATC 3 cut(s) 151, 244, 430
LmnI GCTCC 2 cut(s) 160, 300
LpnPI CCDG 1 cut(s) 233
LweI GCATC 1 cut(s) 274
MaeI CTAG 2 cut(s) 225, 272
MalI GATC 3 cut(s) 153, 246, 432
MboI GATC 3 cut(s) 151, 244, 430
MboII GAAGA 2 cut(s) 4, 353
MfeI CAATTG 1 cut(s) 101
MlsI TGGCCA 1 cut(s) 180
MluCI AATT 3 cut(s) 101, 174, 256
MluNI TGGCCA 1 cut(s) 180
MnlI CCTC 3 cut(s) 131, 384, 414
Mox20I TGGCCA 1 cut(s) 180
Mph1103I ATGCAT 1 cut(s) 44
MscI TGGCCA 1 cut(s) 180
MseI TTAA 2 cut(s) 92, 261
Msp20I TGGCCA 1 cut(s) 180
MunI CAATTG 1 cut(s) 101
MwoI GCNNNNNNNGC 1 cut(s) 314
NdeI CATATG 1 cut(s) 286
NdeII GATC 3 cut(s) 151, 244, 430
NlaIII CATG 1 cut(s) 237
NlaIV GGNNCC 1 cut(s) 252
NsiI ATGCAT 1 cut(s) 44
PfeI GAWTC 1 cut(s) 348
PpuMI RGGWCCY 1 cut(s) 251
Psp5II RGGWCCY 1 cut(s) 251
PspN4I GGNNCC 1 cut(s) 252
PspPI GGNCC 1 cut(s) 251
PspPPI RGGWCCY 1 cut(s) 251
RsaI GTAC 2 cut(s) 389, 419
RsaNI GTAC 2 cut(s) 388, 418
SaqAI TTAA 2 cut(s) 92, 261
Sau3AI GATC 3 cut(s) 151, 244, 430
Sau96I GGNCC 1 cut(s) 251
SetI ASST 4 cut(s) 273, 310, 319, 337
SfaNI GCATC 1 cut(s) 274
SinI GGWCC 1 cut(s) 251
SmlI CTYRAG 1 cut(s) 360
SmoI CTYRAG 1 cut(s) 360
SpeI ACTAGT 1 cut(s) 224
Sse9I AATT 3 cut(s) 101, 174, 256
SspMI CTAG 2 cut(s) 225, 272
TaqI TCGA 1 cut(s) 23
TasI AATT 3 cut(s) 101, 174, 256
TfiI GAWTC 1 cut(s) 348
Tru1I TTAA 2 cut(s) 92, 261
Tru9I TTAA 2 cut(s) 92, 261
TspDTI ATGAA 3 cut(s) 4, 17, 119
VpaK11BI GGWCC 1 cut(s) 251
XspI CTAG 2 cut(s) 225, 272
Zsp2I ATGCAT 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.