AT2G24880

Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Reverse (-)
10590554 .. 10590862
309 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G24880.1

Sequence Viewer

Length: 309 bp
ATGAAAAACTTTTCAATCTTTCTATTCGTGTTTAGTCTTTGCATGTTTGACCATGTATCCAGCTCTGGATTCAAGATCACGAACGAACTCAAATCCAATAAACTTCTTCGGATTGGATGTTATTCCAAAGATGACATATTCGGTCCAAAAACAATACCAATAGGACAACATGTTGAAATCAATTTTACTATTAATTTTTGGCATACAACACGTTTTATGTGTAATTTGGAACAAGGACCTAACTATAAACATTATCAGAAATTTACAGCATACAAGGTTTCCGGTTTTATGGTTGAGGAAGGCATATAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.9

Weight (kDa)

8.83

Isoelectric Point (pI)

23.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 25 - 96 1.4e-17 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 260
AflIII ACRYGT 2 cut(s) 169, 209
AgsI TTSAA 3 cut(s) 15, 73, 176
AluBI AGCT 1 cut(s) 63
AluI AGCT 1 cut(s) 63
ApoI RAATTY 1 cut(s) 260
AseI ATTAAT 1 cut(s) 192
AspS9I GGNCC 2 cut(s) 143, 236
AvaII GGWCC 2 cut(s) 143, 236
BciVI GTATCC 1 cut(s) 67
BfuI GTATCC 1 cut(s) 67
Bme18I GGWCC 2 cut(s) 143, 236
BmgT120I GGNCC 2 cut(s) 143, 236
BsaWI WCCGGW 1 cut(s) 281
BseGI GGATG 1 cut(s) 122
BsiSI CCGG 1 cut(s) 282
Bsp143I GATC 1 cut(s) 75
BssMI GATC 1 cut(s) 75
BstF5I GGATG 1 cut(s) 122
BstKTI GATC 1 cut(s) 78
BstMBI GATC 1 cut(s) 75
BstNSI RCATGY 2 cut(s) 46, 173
BsuI GTATCC 1 cut(s) 67
BtsCI GGATG 1 cut(s) 122
Cfr13I GGNCC 2 cut(s) 143, 236
CviAII CATG 3 cut(s) 43, 53, 170
CviJI RGCY 1 cut(s) 63
CviKI_1 RGCY 1 cut(s) 63
DpnI GATC 1 cut(s) 77
DpnII GATC 1 cut(s) 75
Eco47I GGWCC 2 cut(s) 143, 236
EcoO109I RGGNCCY 1 cut(s) 236
FaeI CATG 3 cut(s) 46, 56, 173
FatI CATG 3 cut(s) 42, 52, 169
FokI GGATG 1 cut(s) 129
HapII CCGG 1 cut(s) 282
Hin1II CATG 3 cut(s) 46, 56, 173
HinfI GANTC 1 cut(s) 69
HpaII CCGG 1 cut(s) 282
Hpy188I TCNGA 2 cut(s) 111, 258
Hpy188III TCNNGA 3 cut(s) 66, 73, 79
HpyAV CCTTC 1 cut(s) 293
HpyCH4IV ACGT 1 cut(s) 211
HpyCH4V TGCA 1 cut(s) 42
HpySE526I ACGT 1 cut(s) 211
Hsp92II CATG 3 cut(s) 46, 56, 173
Kzo9I GATC 1 cut(s) 75
LpnPI CCDG 3 cut(s) 51, 73, 295
MaeII ACGT 1 cut(s) 211
MalI GATC 1 cut(s) 77
MboI GATC 1 cut(s) 75
MboII GAAGA 1 cut(s) 98
MluCI AATT 4 cut(s) 181, 193, 223, 260
MnlI CCTC 1 cut(s) 289
MseI TTAA 1 cut(s) 192
MspI CCGG 1 cut(s) 282
NdeII GATC 1 cut(s) 75
NlaIII CATG 3 cut(s) 46, 56, 173
NspI RCATGY 2 cut(s) 46, 173
PciI ACATGT 1 cut(s) 169
PfeI GAWTC 1 cut(s) 69
PpuMI RGGWCCY 1 cut(s) 236
PscI ACATGT 1 cut(s) 169
PshBI ATTAAT 1 cut(s) 192
Psp5II RGGWCCY 1 cut(s) 236
PspPI GGNCC 2 cut(s) 143, 236
PspPPI RGGWCCY 1 cut(s) 236
SaqAI TTAA 1 cut(s) 192
Sau3AI GATC 1 cut(s) 75
Sau96I GGNCC 2 cut(s) 143, 236
SetI ASST 4 cut(s) 65, 214, 241, 279
SinI GGWCC 2 cut(s) 143, 236
Sse9I AATT 4 cut(s) 181, 193, 223, 260
TaiI ACGT 1 cut(s) 214
TaqII GACCGA 1 cut(s) 131
TasI AATT 4 cut(s) 181, 193, 223, 260
TfiI GAWTC 1 cut(s) 69
Tru1I TTAA 1 cut(s) 192
Tru9I TTAA 1 cut(s) 192
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 2 cut(s) 143, 236
VspI ATTAAT 1 cut(s) 192
XapI RAATTY 1 cut(s) 260
XceI RCATGY 2 cut(s) 46, 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.