Prupe.1G219300_v2.0.a1

Plant self-incompatibility protein S1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0000986
Physical Location & Seq
Reverse (-)
23402074 .. 23403643
1570 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G219300.1

Sequence Viewer

Length: 324 bp
ATGGATGTTATAAACTGCGACAAGCATGTCACACCCTTTAAGAAGTTCTTTGTACGCATTGTTAACAACTTGGATAATAAAAGGTTGGACTTCGATTGCCGATCCGAAGACAGTGTTATTGATCGTAGTCTTCCTGCCAGTGGGGATGAGTTTGAATTTGGATTTCGTGTGAACTTCCAATTCACCACATATTTTTTCTGCAATTTGTGGTCCTTGGACCACCTTTTATCACAAGTGACATGTCATAATTGGCCTTTTGCTATACCCGTTTCACACAAGGGTTTCTCCTGTTTGGGGGTTAGGGGGTCATCTTGGCCAAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

108

Amino Acids

12.43

Weight (kDa)

6.38

Isoelectric Point (pI)

48.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 11
AasI GACNNNNNNGTC 1 cut(s) 26
AclWI GGATC 1 cut(s) 96
AcoI YGGCCR 1 cut(s) 314
AcsI RAATTY 1 cut(s) 155
AfaI GTAC 1 cut(s) 54
AfiI CCNNNNNNNGG 2 cut(s) 140, 294
AflIII ACRYGT 1 cut(s) 239
AgsI TTSAA 1 cut(s) 155
AlwI GGATC 1 cut(s) 96
AoxI GGCC 2 cut(s) 251, 314
ApoI RAATTY 1 cut(s) 155
AspS9I GGNCC 2 cut(s) 210, 217
AsuHPI GGTGA 1 cut(s) 175
AvaII GGWCC 2 cut(s) 210, 217
BalI TGGCCA 1 cut(s) 316
BbsI GAAGAC 2 cut(s) 114, 122
Bme18I GGWCC 2 cut(s) 210, 217
BmgT120I GGNCC 2 cut(s) 210, 217
BpiI GAAGAC 2 cut(s) 114, 122
BsaJI CCNNGG 1 cut(s) 213
Bsc4I CCNNNNNNNGG 2 cut(s) 140, 294
Bse1I ACTGG 1 cut(s) 138
BseDI CCNNGG 1 cut(s) 213
BseGI GGATG 2 cut(s) 10, 151
BseLI CCNNNNNNNGG 2 cut(s) 140, 294
BseNI ACTGG 1 cut(s) 138
BshFI GGCC 2 cut(s) 253, 316
BslI CCNNNNNNNGG 2 cut(s) 140, 294
BsnI GGCC 2 cut(s) 253, 316
Bsp143I GATC 2 cut(s) 101, 121
BspANI GGCC 2 cut(s) 253, 316
BspPI GGATC 1 cut(s) 96
BsrI ACTGG 1 cut(s) 138
BssECI CCNNGG 1 cut(s) 213
BssMI GATC 2 cut(s) 101, 121
BssT1I CCWWGG 1 cut(s) 213
Bst4CI ACNGT 1 cut(s) 113
BstF5I GGATG 2 cut(s) 10, 151
BstKTI GATC 2 cut(s) 104, 124
BstMBI GATC 2 cut(s) 101, 121
BstNSI RCATGY 2 cut(s) 29, 243
BstV2I GAAGAC 2 cut(s) 114, 122
BsuRI GGCC 2 cut(s) 253, 316
BtsCI GGATG 2 cut(s) 10, 151
BtsIMutI CAGTG 2 cut(s) 118, 145
Cfr13I GGNCC 2 cut(s) 210, 217
Csp6I GTAC 1 cut(s) 53
CviAII CATG 2 cut(s) 26, 240
CviJI RGCY 2 cut(s) 253, 316
CviKI_1 RGCY 2 cut(s) 253, 316
CviQI GTAC 1 cut(s) 53
DpnI GATC 2 cut(s) 103, 123
DpnII GATC 2 cut(s) 101, 121
DrdI GACNNNNNNGTC 1 cut(s) 26
DseDI GACNNNNNNGTC 1 cut(s) 26
EaeI YGGCCR 1 cut(s) 314
Eco130I CCWWGG 1 cut(s) 213
Eco47I GGWCC 2 cut(s) 210, 217
EcoT14I CCWWGG 1 cut(s) 213
ErhI CCWWGG 1 cut(s) 213
FaeI CATG 2 cut(s) 29, 243
FaiI YATR 6 cut(s) 11, 27, 190, 241, 246, 263
FalI AAGNNNNNCTT 2 cut(s) 32, 64
FatI CATG 2 cut(s) 25, 239
FokI GGATG 2 cut(s) 17, 158
HaeIII GGCC 2 cut(s) 253, 316
Hin1II CATG 2 cut(s) 29, 243
HincII GTYRAC 1 cut(s) 64
HindII GTYRAC 1 cut(s) 64
HpaI GTTAAC 1 cut(s) 64
HphI GGTGA 1 cut(s) 175
Hpy166II GTNNAC 2 cut(s) 64, 172
Hpy188I TCNGA 1 cut(s) 106
Hpy8I GTNNAC 2 cut(s) 64, 172
HpyCH4III ACNGT 1 cut(s) 113
HpyCH4V TGCA 1 cut(s) 201
Hsp92II CATG 2 cut(s) 29, 243
KspAI GTTAAC 1 cut(s) 64
Kzo9I GATC 2 cut(s) 101, 121
LpnPI CCDG 3 cut(s) 147, 151, 301
MaeIII GTNAC 2 cut(s) 28, 235
MalI GATC 2 cut(s) 103, 123
MboI GATC 2 cut(s) 101, 121
MboII GAAGA 2 cut(s) 119, 122
MlsI TGGCCA 1 cut(s) 316
MluCI AATT 4 cut(s) 155, 179, 202, 247
MluNI TGGCCA 1 cut(s) 316
MmeI TCCRAC 1 cut(s) 66
Mox20I TGGCCA 1 cut(s) 316
MscI TGGCCA 1 cut(s) 316
MseI TTAA 2 cut(s) 39, 63
Msp20I TGGCCA 1 cut(s) 316
NdeII GATC 2 cut(s) 101, 121
NlaIII CATG 2 cut(s) 29, 243
NmuCI GTSAC 2 cut(s) 28, 235
NspI RCATGY 2 cut(s) 29, 243
PciI ACATGT 1 cut(s) 239
PscI ACATGT 1 cut(s) 239
PsiI TTATAA 1 cut(s) 11
PspPI GGNCC 2 cut(s) 210, 217
RsaI GTAC 1 cut(s) 54
RsaNI GTAC 1 cut(s) 53
SaqAI TTAA 2 cut(s) 39, 63
Sau3AI GATC 2 cut(s) 101, 121
Sau96I GGNCC 2 cut(s) 210, 217
SetI ASST 2 cut(s) 86, 225
SinI GGWCC 2 cut(s) 210, 217
Sse9I AATT 4 cut(s) 155, 179, 202, 247
StyI CCWWGG 1 cut(s) 213
TaaI ACNGT 1 cut(s) 113
TaqI TCGA 1 cut(s) 93
TasI AATT 4 cut(s) 155, 179, 202, 247
Tru1I TTAA 2 cut(s) 39, 63
Tru9I TTAA 2 cut(s) 39, 63
TscAI CASTG 2 cut(s) 118, 145
TseFI GTSAC 2 cut(s) 28, 235
Tsp45I GTSAC 2 cut(s) 28, 235
TspRI CASTG 2 cut(s) 118, 145
VpaK11BI GGWCC 2 cut(s) 210, 217
XapI RAATTY 1 cut(s) 155
XceI RCATGY 2 cut(s) 29, 243
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.