RchiOBHm_Chr4g0396541

Plant self-incompatibility protein S1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0000986
Physical Location & Seq
Forward (+)
12670144 .. 12670542
399 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36891

Sequence Viewer

Length: 399 bp
ATGTCTTTCACTGCCAACTGTTCTTGTGTGATCATCACCTTGGCCCTAGCAACCTTGACATTAACATTTTCTGAAGGGTACAAATCGTACAATGTTCACATCATCAATCGCTTTTGCAACAACGATAAGCCATTGACTGTTCATTGCAAATCTGGAGACGATGATCTCGGTAACCACACCCTATGGAGAGGTCAGGATTACAACTGGCAATTTAACGGAAACTTTTGGGGTACAACTCTCTTCCACTGCAATATGAAACGGGATTCACAAGAGAGAGACATCATTGTTTTTAGTATTGCTGATGAGGAACCCCTTGAGTGCATGAAAACCAAGGATTGCTTTTGGTTCGTGAATGAGGATGGTTTCTATGTTGGCAATAAAAAGTTCGACTGGCGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

132

Amino Acids

15.45

Weight (kDa)

5.46

Isoelectric Point (pI)

35.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 31 - 127 4.9e-26 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 93
AfaI GTAC 3 cut(s) 80, 89, 232
Alw26I GTCTC 2 cut(s) 150, 270
AoxI GGCC 1 cut(s) 42
AspS9I GGNCC 1 cut(s) 43
AsuHPI GGTGA 1 cut(s) 28
BccI CCATC 1 cut(s) 353
BclI TGATCA 1 cut(s) 30
BcoDI GTCTC 2 cut(s) 150, 270
BfaI CTAG 1 cut(s) 47
BmgT120I GGNCC 1 cut(s) 43
BmiI GGNNCC 1 cut(s) 309
BpmI CTGGAG 1 cut(s) 174
BpuEI CTTGAG 1 cut(s) 335
BsaJI CCNNGG 2 cut(s) 39, 330
Bse1I ACTGG 2 cut(s) 209, 395
Bse3DI GCAATG 1 cut(s) 142
BseDI CCNNGG 2 cut(s) 39, 330
BseGI GGATG 1 cut(s) 364
BseMI GCAATG 1 cut(s) 142
BseNI ACTGG 2 cut(s) 209, 395
BshFI GGCC 1 cut(s) 44
BsmAI GTCTC 2 cut(s) 150, 270
BsmBI CGTCTC 1 cut(s) 150
BsnI GGCC 1 cut(s) 44
Bsp143I GATC 2 cut(s) 30, 163
BspANI GGCC 1 cut(s) 44
BspLI GGNNCC 1 cut(s) 309
BsrDI GCAATG 1 cut(s) 142
BsrI ACTGG 2 cut(s) 209, 395
BssECI CCNNGG 2 cut(s) 39, 330
BssMI GATC 2 cut(s) 30, 163
BssT1I CCWWGG 2 cut(s) 39, 330
Bst4CI ACNGT 2 cut(s) 20, 139
Bst6I CTCTTC 1 cut(s) 245
BstEII GGTNACC 1 cut(s) 170
BstF5I GGATG 1 cut(s) 364
BstKTI GATC 2 cut(s) 33, 166
BstMAI GTCTC 2 cut(s) 150, 270
BstMBI GATC 2 cut(s) 30, 163
BstPI GGTNACC 1 cut(s) 170
BsuRI GGCC 1 cut(s) 44
BtsCI GGATG 1 cut(s) 364
BtsI GCAGTG 2 cut(s) 9, 244
BtsIMutI CAGTG 2 cut(s) 9, 244
Cfr13I GGNCC 1 cut(s) 43
Csp6I GTAC 3 cut(s) 79, 88, 231
CviAII CATG 1 cut(s) 322
CviJI RGCY 2 cut(s) 44, 130
CviKI_1 RGCY 2 cut(s) 44, 130
CviQI GTAC 3 cut(s) 79, 88, 231
DpnI GATC 2 cut(s) 32, 165
DpnII GATC 2 cut(s) 30, 163
Eam1104I CTCTTC 1 cut(s) 245
EarI CTCTTC 1 cut(s) 245
Eco130I CCWWGG 2 cut(s) 39, 330
Eco57I CTGAAG 1 cut(s) 93
Eco91I GGTNACC 1 cut(s) 170
EcoO65I GGTNACC 1 cut(s) 170
EcoT14I CCWWGG 2 cut(s) 39, 330
ErhI CCWWGG 2 cut(s) 39, 330
Esp3I CGTCTC 1 cut(s) 150
FaeI CATG 1 cut(s) 325
FaiI YATR 4 cut(s) 184, 254, 323, 369
FalI AAGNNNNNCTT 2 cut(s) 323, 355
FatI CATG 1 cut(s) 321
FbaI TGATCA 1 cut(s) 30
FokI GGATG 1 cut(s) 371
FspBI CTAG 1 cut(s) 47
GsuI CTGGAG 1 cut(s) 174
HaeIII GGCC 1 cut(s) 44
Hin1II CATG 1 cut(s) 325
HinfI GANTC 1 cut(s) 263
HphI GGTGA 1 cut(s) 28
Hpy166II GTNNAC 1 cut(s) 97
Hpy188I TCNGA 1 cut(s) 73
Hpy188III TCNNGA 3 cut(s) 153, 194, 349
Hpy8I GTNNAC 1 cut(s) 97
HpyAV CCTTC 1 cut(s) 68
HpyCH4III ACNGT 2 cut(s) 20, 139
HpyCH4V TGCA 4 cut(s) 117, 147, 249, 321
Hsp92II CATG 1 cut(s) 325
Ksp22I TGATCA 1 cut(s) 30
Kzo9I GATC 2 cut(s) 30, 163
LpnPI CCDG 4 cut(s) 138, 179, 190, 376
MaeI CTAG 1 cut(s) 47
MaeIII GTNAC 1 cut(s) 170
MalI GATC 2 cut(s) 32, 165
MboI GATC 2 cut(s) 30, 163
MboII GAAGA 1 cut(s) 232
MluCI AATT 1 cut(s) 209
MnlI CCTC 3 cut(s) 182, 298, 349
MseI TTAA 2 cut(s) 62, 213
NdeII GATC 2 cut(s) 30, 163
NlaIII CATG 1 cut(s) 325
NlaIV GGNNCC 1 cut(s) 309
PfeI GAWTC 1 cut(s) 263
PspEI GGTNACC 1 cut(s) 170
PspN4I GGNNCC 1 cut(s) 309
PspPI GGNCC 1 cut(s) 43
RsaI GTAC 3 cut(s) 80, 89, 232
RsaNI GTAC 3 cut(s) 79, 88, 231
SaqAI TTAA 2 cut(s) 62, 213
Sau3AI GATC 2 cut(s) 30, 163
Sau96I GGNCC 1 cut(s) 43
SetI ASST 3 cut(s) 41, 56, 193
SmlI CTYRAG 1 cut(s) 314
SmoI CTYRAG 1 cut(s) 314
Sse9I AATT 1 cut(s) 209
SspMI CTAG 1 cut(s) 47
StyI CCWWGG 2 cut(s) 39, 330
TaaI ACNGT 2 cut(s) 20, 139
TaqI TCGA 1 cut(s) 387
TasI AATT 1 cut(s) 209
TfiI GAWTC 1 cut(s) 263
Tru1I TTAA 2 cut(s) 62, 213
Tru9I TTAA 2 cut(s) 62, 213
TscAI CASTG 2 cut(s) 16, 251
TspDTI ATGAA 3 cut(s) 131, 269, 338
TspGWI ACGGA 1 cut(s) 231
TspRI CASTG 2 cut(s) 16, 251
XspI CTAG 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.