AT5G38440

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0000986
Physical Location & Seq
Forward (+)
15390223 .. 15390624
402 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G38440.1

Sequence Viewer

Length: 402 bp
ATGAATCGGCTCTCGTGTTTTCTGCTCGTTATTGGATTGTGCATAGGATTGAGTAACGCAAATTTAATATGGAATGAGAAAAACACTGTATTCTTCAAGAGTTCCCTTGGTCGAAACAATGTTTTGAAGATTCATTGCACATCAGAAGACAATCTAGGTTTCCATTTTTTGCGTCCTGGAGAAACCTATGATTTTAGTTTCCATGATAGTATTGTGAGATCAGACTTTTACTGTGAATTATGGCAAGGGCCTAATTTCAAGTTTCATGCATCATTTATGGCATATCAAGGTGGTGGTCTCATAGTTCATTATGGTAAAAAGAACTTTTGGGATGCTAGAGAAGATGGAATCTATTTCACTCATGGCAAAGAAACGCCCAAGTTAGAGTATAAGTGGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

133

Amino Acids

15.52

Weight (kDa)

8.34

Isoelectric Point (pI)

28.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 30 - 132 2.1e-26 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 61
AgsI TTSAA 3 cut(s) 97, 127, 259
AjnI CCWGG 1 cut(s) 175
Alw26I GTCTC 1 cut(s) 302
AoxI GGCC 1 cut(s) 248
ApoI RAATTY 1 cut(s) 61
AspS9I GGNCC 1 cut(s) 248
BauI CACGAG 1 cut(s) 13
BbsI GAAGAC 1 cut(s) 153
BccI CCATC 1 cut(s) 338
BciT130I CCWGG 1 cut(s) 177
BcoDI GTCTC 1 cut(s) 302
BfaI CTAG 2 cut(s) 155, 336
Bme1390I CCNGG 1 cut(s) 177
BmgT120I GGNCC 1 cut(s) 248
BmrFI CCNGG 1 cut(s) 177
BmsI GCATC 2 cut(s) 278, 322
BpiI GAAGAC 1 cut(s) 153
BpmI CTGGAG 1 cut(s) 198
BsaI GGTCTC 1 cut(s) 302
BsaJI CCNNGG 1 cut(s) 106
Bse3DI GCAATG 1 cut(s) 133
BseBI CCWGG 1 cut(s) 177
BseDI CCNNGG 1 cut(s) 106
BseGI GGATG 1 cut(s) 337
BseMI GCAATG 1 cut(s) 133
BshFI GGCC 1 cut(s) 250
BsmAI GTCTC 1 cut(s) 302
BsnI GGCC 1 cut(s) 250
Bso31I GGTCTC 1 cut(s) 302
Bsp143I GATC 1 cut(s) 218
BspANI GGCC 1 cut(s) 250
BspTNI GGTCTC 1 cut(s) 302
BsrDI GCAATG 1 cut(s) 133
BssECI CCNNGG 1 cut(s) 106
BssMI GATC 1 cut(s) 218
BssSI CACGAG 1 cut(s) 13
BssT1I CCWWGG 1 cut(s) 106
Bst2BI CACGAG 1 cut(s) 13
Bst2UI CCWGG 1 cut(s) 177
Bst4CI ACNGT 2 cut(s) 88, 233
BstF5I GGATG 1 cut(s) 337
BstKTI GATC 1 cut(s) 221
BstMAI GTCTC 1 cut(s) 302
BstMBI GATC 1 cut(s) 218
BstNI CCWGG 1 cut(s) 177
BstSCI CCNGG 1 cut(s) 175
BstV2I GAAGAC 1 cut(s) 153
BsuRI GGCC 1 cut(s) 250
BtsCI GGATG 1 cut(s) 337
BtsIMutI CAGTG 1 cut(s) 84
Cfr13I GGNCC 1 cut(s) 248
CseI GACGC 1 cut(s) 161
CviAII CATG 3 cut(s) 203, 266, 362
CviJI RGCY 2 cut(s) 10, 250
CviKI_1 RGCY 2 cut(s) 10, 250
DpnI GATC 1 cut(s) 220
DpnII GATC 1 cut(s) 218
Eco130I CCWWGG 1 cut(s) 106
Eco31I GGTCTC 1 cut(s) 302
EcoO109I RGGNCCY 1 cut(s) 248
EcoRII CCWGG 1 cut(s) 175
EcoT14I CCWWGG 1 cut(s) 106
EcoT22I ATGCAT 1 cut(s) 271
ErhI CCWWGG 1 cut(s) 106
FaeI CATG 3 cut(s) 206, 269, 365
FatI CATG 3 cut(s) 202, 265, 361
FokI GGATG 1 cut(s) 344
FspBI CTAG 2 cut(s) 155, 336
GsuI CTGGAG 1 cut(s) 198
HaeIII GGCC 1 cut(s) 250
HgaI GACGC 1 cut(s) 161
Hin1II CATG 3 cut(s) 206, 269, 365
HinfI GANTC 3 cut(s) 4, 130, 348
Hpy188I TCNGA 2 cut(s) 145, 223
Hpy188III TCNNGA 1 cut(s) 97
HpyCH4III ACNGT 2 cut(s) 88, 233
HpyCH4V TGCA 3 cut(s) 42, 138, 269
Hsp92II CATG 3 cut(s) 206, 269, 365
Kzo9I GATC 1 cut(s) 218
LpnPI CCDG 2 cut(s) 162, 189
LweI GCATC 2 cut(s) 278, 322
MaeI CTAG 2 cut(s) 155, 336
MaeIII GTNAC 1 cut(s) 53
MalI GATC 1 cut(s) 220
MboI GATC 1 cut(s) 218
MboII GAAGA 4 cut(s) 85, 139, 158, 353
MluCI AATT 3 cut(s) 61, 236, 253
Mph1103I ATGCAT 1 cut(s) 271
MseI TTAA 1 cut(s) 65
MspR9I CCNGG 1 cut(s) 177
MvaI CCWGG 1 cut(s) 177
NdeII GATC 1 cut(s) 218
NlaIII CATG 3 cut(s) 206, 269, 365
NsiI ATGCAT 1 cut(s) 271
PfeI GAWTC 3 cut(s) 4, 130, 348
PfoI TCCNGGA 1 cut(s) 175
Psp6I CCWGG 1 cut(s) 175
PspGI CCWGG 1 cut(s) 175
PspPI GGNCC 1 cut(s) 248
SaqAI TTAA 1 cut(s) 65
Sau3AI GATC 1 cut(s) 218
Sau96I GGNCC 1 cut(s) 248
ScrFI CCNGG 1 cut(s) 177
SetI ASST 3 cut(s) 160, 188, 292
SfaNI GCATC 2 cut(s) 278, 322
Sse9I AATT 3 cut(s) 61, 236, 253
SspMI CTAG 2 cut(s) 155, 336
StyD4I CCNGG 1 cut(s) 175
StyI CCWWGG 1 cut(s) 106
TaaI ACNGT 2 cut(s) 88, 233
TaqI TCGA 1 cut(s) 112
TasI AATT 3 cut(s) 61, 236, 253
TfiI GAWTC 3 cut(s) 4, 130, 348
Tru1I TTAA 1 cut(s) 65
Tru9I TTAA 1 cut(s) 65
TscAI CASTG 1 cut(s) 91
TspDTI ATGAA 4 cut(s) 17, 122, 254, 296
TspRI CASTG 1 cut(s) 91
XapI RAATTY 1 cut(s) 61
XspI CTAG 2 cut(s) 155, 336
Zsp2I ATGCAT 1 cut(s) 271
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.