Rmu_sc0001781.1_g000005

Plant self-incompatibility protein S1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001781.1
OG0000986
Physical Location & Seq
Reverse (-)
36306 .. 36740
435 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001781.1_g000005.1.cds

Sequence Viewer

Length: 435 bp
atgtctttcaccgccagttgctcttgtgtgatcatcaccttggtcctagcaaccctgacaataacatattctgaagcgacagctgtgaaatggactcactggcacaacgttcacgtcgtcaatggcttttcccgcaacgatgagccattgattgttcattgcaaatctaaaaacgatgatcttggtgaccacacactatggattaatcaagagtttcgctggcatttcggcctgaacttttggtttacgactctcttctattgcaatttcaaatgggattcacaagagaaacacatcgacgttttcaatactcctgatgaaagcccccttgagtgcatggaaaatgaggagtgcttttggaaagtgactgaggatggtttcttcgttagcgttgataatataaactgggttaaaaagttgaattggcatgactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

144

Amino Acids

17.08

Weight (kDa)

5.09

Isoelectric Point (pI)

51.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 12, 133
AclI AACGTT 1 cut(s) 108
AcuI CTGAAG 1 cut(s) 93
AgsI TTSAA 3 cut(s) 271, 307, 421
AjiI CACGTC 1 cut(s) 115
AluBI AGCT 1 cut(s) 83
AluI AGCT 1 cut(s) 83
AoxI GGCC 1 cut(s) 229
AseI ATTAAT 1 cut(s) 204
AspS9I GGNCC 1 cut(s) 43
AsuHPI GGTGA 2 cut(s) 28, 197
AvaII GGWCC 1 cut(s) 43
BccI CCATC 1 cut(s) 368
BclI TGATCA 1 cut(s) 30
BfaI CTAG 2 cut(s) 47, 433
Bme18I GGWCC 1 cut(s) 43
BmgBI CACGTC 1 cut(s) 115
BmgT120I GGNCC 1 cut(s) 43
BmrI ACTGGG 1 cut(s) 415
BmuI ACTGGG 1 cut(s) 415
BpuEI CTTGAG 1 cut(s) 350
BsaJI CCNNGG 1 cut(s) 39
Bse1I ACTGG 3 cut(s) 15, 104, 410
Bse3DI GCAATG 1 cut(s) 157
BseDI CCNNGG 1 cut(s) 39
BseGI GGATG 1 cut(s) 379
BseMI GCAATG 1 cut(s) 157
BseMII CTCAG 1 cut(s) 360
BseNI ACTGG 3 cut(s) 15, 104, 410
BseRI GAGGAG 1 cut(s) 362
BshFI GGCC 1 cut(s) 231
BsnI GGCC 1 cut(s) 231
Bsp143I GATC 2 cut(s) 30, 178
BspACI CCGC 2 cut(s) 12, 133
BspANI GGCC 1 cut(s) 231
BspCNI CTCAG 1 cut(s) 361
BsrDI GCAATG 1 cut(s) 157
BsrI ACTGG 3 cut(s) 15, 104, 410
BssECI CCNNGG 1 cut(s) 39
BssMI GATC 2 cut(s) 30, 178
BssT1I CCWWGG 1 cut(s) 39
Bst6I CTCTTC 1 cut(s) 260
BstC8I GCNNGC 1 cut(s) 221
BstDEI CTNAG 1 cut(s) 369
BstEII GGTNACC 1 cut(s) 185
BstF5I GGATG 1 cut(s) 379
BstKTI GATC 2 cut(s) 33, 181
BstMBI GATC 2 cut(s) 30, 178
BstMWI GCNNNNNNNGC 1 cut(s) 132
BstPI GGTNACC 1 cut(s) 185
BsuRI GGCC 1 cut(s) 231
BtrI CACGTC 1 cut(s) 115
BtsCI GGATG 1 cut(s) 379
BtsIMutI CAGTG 1 cut(s) 97
Cac8I GCNNGC 1 cut(s) 221
Cfr13I GGNCC 1 cut(s) 43
CviAII CATG 2 cut(s) 337, 428
CviJI RGCY 5 cut(s) 83, 126, 145, 231, 324
CviKI_1 RGCY 5 cut(s) 83, 126, 145, 231, 324
DdeI CTNAG 1 cut(s) 369
DpnI GATC 2 cut(s) 32, 180
DpnII GATC 2 cut(s) 30, 178
Eam1104I CTCTTC 1 cut(s) 260
EarI CTCTTC 1 cut(s) 260
Eco130I CCWWGG 1 cut(s) 39
Eco47I GGWCC 1 cut(s) 43
Eco57I CTGAAG 1 cut(s) 93
Eco91I GGTNACC 1 cut(s) 185
EcoO65I GGTNACC 1 cut(s) 185
EcoT14I CCWWGG 1 cut(s) 39
ErhI CCWWGG 1 cut(s) 39
FaeI CATG 2 cut(s) 340, 431
FaiI YATR 5 cut(s) 67, 199, 338, 401, 429
FatI CATG 2 cut(s) 336, 427
FauI CCCGC 1 cut(s) 140
FbaI TGATCA 1 cut(s) 30
FokI GGATG 1 cut(s) 386
FspBI CTAG 2 cut(s) 47, 433
HaeIII GGCC 1 cut(s) 231
Hin1II CATG 2 cut(s) 340, 431
HinfI GANTC 3 cut(s) 94, 250, 278
HphI GGTGA 2 cut(s) 28, 197
Hpy166II GTNNAC 2 cut(s) 112, 246
Hpy188I TCNGA 1 cut(s) 73
Hpy188III TCNNGA 2 cut(s) 209, 314
Hpy8I GTNNAC 2 cut(s) 112, 246
Hpy99I CGWCG 2 cut(s) 119, 302
HpyCH4IV ACGT 3 cut(s) 108, 114, 300
HpyCH4V TGCA 3 cut(s) 162, 264, 336
HpyF10VI GCNNNNNNNGC 1 cut(s) 132
HpyF3I CTNAG 1 cut(s) 369
HpySE526I ACGT 3 cut(s) 108, 114, 300
Hsp92II CATG 2 cut(s) 340, 431
Ksp22I TGATCA 1 cut(s) 30
Kzo9I GATC 2 cut(s) 30, 178
LpnPI CCDG 7 cut(s) 28, 68, 85, 205, 245, 327, 391
MaeI CTAG 2 cut(s) 47, 433
MaeII ACGT 3 cut(s) 108, 114, 300
MaeIII GTNAC 2 cut(s) 185, 364
MalI GATC 2 cut(s) 32, 180
MboI GATC 2 cut(s) 30, 178
MboII GAAGA 2 cut(s) 247, 373
MluCI AATT 2 cut(s) 265, 421
MlyI GAGTC 2 cut(s) 88, 244
MnlI CCTC 2 cut(s) 340, 364
MseI TTAA 2 cut(s) 204, 411
MspA1I CMGCKG 1 cut(s) 83
MwoI GCNNNNNNNGC 1 cut(s) 132
NdeII GATC 2 cut(s) 30, 178
NlaIII CATG 2 cut(s) 340, 431
NmuCI GTSAC 2 cut(s) 185, 364
PcsI WCGNNNNNNNCGW 1 cut(s) 114
PfeI GAWTC 1 cut(s) 278
PleI GAGTC 2 cut(s) 88, 244
PpsI GAGTC 2 cut(s) 88, 244
PshBI ATTAAT 1 cut(s) 204
Psp1406I AACGTT 1 cut(s) 108
PspEI GGTNACC 1 cut(s) 185
PspPI GGNCC 1 cut(s) 43
PvuII CAGCTG 1 cut(s) 83
SaqAI TTAA 2 cut(s) 204, 411
Sau3AI GATC 2 cut(s) 30, 178
Sau96I GGNCC 1 cut(s) 43
SchI GAGTC 2 cut(s) 88, 244
SetI ASST 5 cut(s) 41, 85, 111, 117, 303
SinI GGWCC 1 cut(s) 43
SmlI CTYRAG 1 cut(s) 329
SmoI CTYRAG 1 cut(s) 329
Sse9I AATT 2 cut(s) 265, 421
SsiI CCGC 2 cut(s) 12, 133
SspMI CTAG 2 cut(s) 47, 433
StyI CCWWGG 1 cut(s) 39
TaiI ACGT 3 cut(s) 111, 117, 303
TaqI TCGA 1 cut(s) 297
TasI AATT 2 cut(s) 265, 421
TfiI GAWTC 1 cut(s) 278
Tru1I TTAA 2 cut(s) 204, 411
Tru9I TTAA 2 cut(s) 204, 411
TscAI CASTG 1 cut(s) 104
TseFI GTSAC 2 cut(s) 185, 364
Tsp45I GTSAC 2 cut(s) 185, 364
TspDTI ATGAA 2 cut(s) 146, 333
TspRI CASTG 1 cut(s) 104
VpaK11BI GGWCC 1 cut(s) 43
VspI ATTAAT 1 cut(s) 204
XspI CTAG 2 cut(s) 47, 433
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.