Prupe.8G208500_v2.0.a1

Plant self-incompatibility protein S1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
OG0000986
Physical Location & Seq
Forward (+)
19408321 .. 19408752
432 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G208500.1

Sequence Viewer

Length: 432 bp
ATGAATCCAATGAAACCATCCCTATCCTCCATTTCTATGCTCTTACTTGCCCTACTTATCTTCCTGAGCCAAACCCAAGTCACCTATTCACTTTTCAACAAGTACAGGGTGCATATTATCAACGGATTGACGAATGAGACTCTTACAGCTCATTGTAAATCCAAGGACGACGATCTTGGAGTTCATGAACTTGCAGTGGACCAGGAATTTTCATGGGAATTTCGCATCAACTTTTTTGATAGAACACTTTACTTTTGCAATCTGGTGTGGAATGGTGGACATAAAACTTTTGATGCGTTTCTAGTCGATGAGAAAGCTTTGCTGAATTCTTGTAGTTCTTCTGACTGTATGTGGAGAGCAAGAGATGATGGAGTTTACTTGTTTAATTATCCGCACAAACAATATAGACTAAAATATCAATGGGAAAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

144

Amino Acids

16.85

Weight (kDa)

6.5

Isoelectric Point (pI)

23.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 392
AcsI RAATTY 3 cut(s) 206, 218, 325
AfaI GTAC 1 cut(s) 104
AgsI TTSAA 1 cut(s) 97
AjnI CCWGG 1 cut(s) 201
AluBI AGCT 2 cut(s) 149, 317
AluI AGCT 2 cut(s) 149, 317
Alw26I GTCTC 1 cut(s) 131
ApoI RAATTY 3 cut(s) 206, 218, 325
AspS9I GGNCC 1 cut(s) 199
AsuHPI GGTGA 1 cut(s) 73
AvaII GGWCC 1 cut(s) 199
BccI CCATC 2 cut(s) 25, 362
BciT130I CCWGG 1 cut(s) 203
BcoDI GTCTC 1 cut(s) 131
BfaI CTAG 1 cut(s) 302
Bme1390I CCNGG 1 cut(s) 203
Bme18I GGWCC 1 cut(s) 199
BmgT120I GGNCC 1 cut(s) 199
BmrFI CCNGG 1 cut(s) 203
BmsI GCATC 2 cut(s) 234, 283
Bpu10I CCTNAGC 1 cut(s) 65
BsaJI CCNNGG 1 cut(s) 162
BseBI CCWGG 1 cut(s) 203
BseDI CCNNGG 1 cut(s) 162
BseGI GGATG 1 cut(s) 17
BseMII CTCAG 1 cut(s) 56
BsmAI GTCTC 1 cut(s) 131
Bsp143I GATC 1 cut(s) 172
BspACI CCGC 1 cut(s) 392
BspCNI CTCAG 1 cut(s) 57
BspHI TCATGA 1 cut(s) 184
BssECI CCNNGG 1 cut(s) 162
BssMI GATC 1 cut(s) 172
BssT1I CCWWGG 1 cut(s) 162
Bst2UI CCWGG 1 cut(s) 203
Bst4CI ACNGT 1 cut(s) 347
BstDEI CTNAG 1 cut(s) 65
BstF5I GGATG 1 cut(s) 17
BstKTI GATC 1 cut(s) 175
BstMAI GTCTC 1 cut(s) 131
BstMBI GATC 1 cut(s) 172
BstNI CCWGG 1 cut(s) 203
BstSCI CCNGG 1 cut(s) 201
BtsCI GGATG 1 cut(s) 17
BtsI GCAGTG 1 cut(s) 201
BtsIMutI CAGTG 1 cut(s) 201
CciI TCATGA 1 cut(s) 184
Cfr13I GGNCC 1 cut(s) 199
Csp6I GTAC 1 cut(s) 103
CviAII CATG 2 cut(s) 185, 213
CviJI RGCY 3 cut(s) 69, 149, 317
CviKI_1 RGCY 3 cut(s) 69, 149, 317
CviQI GTAC 1 cut(s) 103
DdeI CTNAG 1 cut(s) 65
DpnI GATC 1 cut(s) 174
DpnII GATC 1 cut(s) 172
Eco130I CCWWGG 1 cut(s) 162
Eco47I GGWCC 1 cut(s) 199
EcoRI GAATTC 1 cut(s) 325
EcoRII CCWGG 1 cut(s) 201
EcoT14I CCWWGG 1 cut(s) 162
ErhI CCWWGG 1 cut(s) 162
FaeI CATG 2 cut(s) 188, 216
FaiI YATR 7 cut(s) 38, 114, 186, 214, 282, 350, 405
FatI CATG 2 cut(s) 184, 212
FokI GGATG 1 cut(s) 4
FspBI CTAG 1 cut(s) 302
Hin1II CATG 2 cut(s) 188, 216
HindIII AAGCTT 1 cut(s) 315
HinfI GANTC 2 cut(s) 4, 139
HphI GGTGA 1 cut(s) 73
Hpy166II GTNNAC 3 cut(s) 199, 278, 376
Hpy188I TCNGA 1 cut(s) 343
Hpy188III TCNNGA 2 cut(s) 64, 185
Hpy8I GTNNAC 3 cut(s) 199, 278, 376
Hpy99I CGWCG 1 cut(s) 173
HpyCH4III ACNGT 1 cut(s) 347
HpyCH4V TGCA 3 cut(s) 112, 194, 258
HpyF3I CTNAG 1 cut(s) 65
Hsp92II CATG 2 cut(s) 188, 216
Kzo9I GATC 1 cut(s) 172
LpnPI CCDG 5 cut(s) 77, 91, 188, 215, 248
LweI GCATC 2 cut(s) 234, 283
MaeI CTAG 1 cut(s) 302
MaeIII GTNAC 1 cut(s) 79
MalI GATC 1 cut(s) 174
MboI GATC 1 cut(s) 172
MboII GAAGA 2 cut(s) 52, 330
MluCI AATT 4 cut(s) 206, 218, 325, 385
MlyI GAGTC 1 cut(s) 133
MnlI CCTC 1 cut(s) 37
MseI TTAA 1 cut(s) 384
MslI CAYNNNNRTG 1 cut(s) 35
MspR9I CCNGG 1 cut(s) 203
MvaI CCWGG 1 cut(s) 203
NdeII GATC 1 cut(s) 172
NlaIII CATG 2 cut(s) 188, 216
NmuCI GTSAC 1 cut(s) 79
PagI TCATGA 1 cut(s) 184
PfeI GAWTC 1 cut(s) 4
PleI GAGTC 1 cut(s) 133
PpsI GAGTC 1 cut(s) 133
Psp6I CCWGG 1 cut(s) 201
PspGI CCWGG 1 cut(s) 201
PspPI GGNCC 1 cut(s) 199
RsaI GTAC 1 cut(s) 104
RsaNI GTAC 1 cut(s) 103
RseI CAYNNNNRTG 1 cut(s) 35
SaqAI TTAA 1 cut(s) 384
Sau3AI GATC 1 cut(s) 172
Sau96I GGNCC 1 cut(s) 199
SchI GAGTC 1 cut(s) 133
ScrFI CCNGG 1 cut(s) 203
SetI ASST 3 cut(s) 86, 151, 319
SfaNI GCATC 2 cut(s) 234, 283
SinI GGWCC 1 cut(s) 199
SmiMI CAYNNNNRTG 1 cut(s) 35
Sse9I AATT 4 cut(s) 206, 218, 325, 385
SsiI CCGC 1 cut(s) 392
SspMI CTAG 1 cut(s) 302
StyD4I CCNGG 1 cut(s) 201
StyI CCWWGG 1 cut(s) 162
TaaI ACNGT 1 cut(s) 347
TaqI TCGA 1 cut(s) 306
TasI AATT 4 cut(s) 206, 218, 325, 385
TatI WGTACW 1 cut(s) 102
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 1 cut(s) 384
Tru9I TTAA 1 cut(s) 384
TscAI CASTG 1 cut(s) 201
TseFI GTSAC 1 cut(s) 79
Tsp45I GTSAC 1 cut(s) 79
TspDTI ATGAA 5 cut(s) 17, 26, 173, 201, 201
TspGWI ACGGA 1 cut(s) 138
TspRI CASTG 1 cut(s) 201
VpaK11BI GGWCC 1 cut(s) 199
XapI RAATTY 3 cut(s) 206, 218, 325
XspI CTAG 1 cut(s) 302
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.