AT3G26880

pumilio homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
OG0000986
Physical Location & Seq
Reverse (-)
9906068 .. 9906781
714 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G26880.1

Sequence Viewer

Length: 402 bp
ATGAAAAACCTCTCAATCTTTCTATTTGTTGTTGGGCTTTGCATGATTAGTGATGTATACGGAAAAAAATCTACGATTACGGTCAAGAATGAATTAAATCCCAAAAACAAGAATATCCTCAAGGTGCATTGTAAATCCAAAAACAACGATATTGGTGTAAAATATCTCAAAATTGGAGAAGTTATGTCATTCAGCTTCAAGACCAACTTTTGGGGAACGACGGAATTTTGGTGCAACTTATATAAAGGACCTGATTATAAGCGTTATAGAGGTATTACTGCATATCAAGCTATAGGTTTGTTCGCCAAAGATGGATCATCGTATAATTGGTTAGCTAGAGATGATGGAATCTATTTTCATAAGGATTCGTTGCCTAGCTACTATAAAACTTATTGGCTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

133

Amino Acids

15.5

Weight (kDa)

9.5

Isoelectric Point (pI)

18.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 25 - 131 2e-27 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 258
AccB7I CCANNNNNTGG 1 cut(s) 210
AccI GTMKAC 1 cut(s) 57
AclWI GGATC 1 cut(s) 322
AcsI RAATTY 1 cut(s) 224
AfiI CCNNNNNNNGG 1 cut(s) 210
AgsI TTSAA 1 cut(s) 199
AluBI AGCT 4 cut(s) 195, 290, 335, 378
AluI AGCT 4 cut(s) 195, 290, 335, 378
AlwI GGATC 1 cut(s) 322
ApoI RAATTY 1 cut(s) 224
AspS9I GGNCC 1 cut(s) 248
AvaII GGWCC 1 cut(s) 248
BccI CCATC 2 cut(s) 305, 338
BfaI CTAG 2 cut(s) 336, 375
BfmI CTRYAG 1 cut(s) 291
Bme18I GGWCC 1 cut(s) 248
BmgT120I GGNCC 1 cut(s) 248
BpuEI CTTGAG 1 cut(s) 104
Bsc4I CCNNNNNNNGG 1 cut(s) 210
BseLI CCNNNNNNNGG 1 cut(s) 210
BslI CCNNNNNNNGG 1 cut(s) 210
Bsp143I GATC 1 cut(s) 314
BspPI GGATC 1 cut(s) 322
BssMI GATC 1 cut(s) 314
BssNAI GTATAC 1 cut(s) 58
Bst1107I GTATAC 1 cut(s) 58
Bst4CI ACNGT 1 cut(s) 82
BstKTI GATC 1 cut(s) 317
BstMBI GATC 1 cut(s) 314
BstMWI GCNNNNNNNGC 1 cut(s) 287
BstSFI CTRYAG 1 cut(s) 291
BstZ17I GTATAC 1 cut(s) 58
Cfr13I GGNCC 1 cut(s) 248
CviAII CATG 1 cut(s) 43
CviJI RGCY 6 cut(s) 37, 195, 290, 335, 378, 397
CviKI_1 RGCY 6 cut(s) 37, 195, 290, 335, 378, 397
DpnI GATC 1 cut(s) 316
DpnII GATC 1 cut(s) 314
Eco47I GGWCC 1 cut(s) 248
EcoO109I RGGNCCY 1 cut(s) 248
FaeI CATG 1 cut(s) 46
FalI AAGNNNNNCTT 2 cut(s) 191, 223
FatI CATG 1 cut(s) 42
FblI GTMKAC 1 cut(s) 57
FspBI CTAG 2 cut(s) 336, 375
Hin1II CATG 1 cut(s) 46
HinfI GANTC 2 cut(s) 348, 365
Hpy166II GTNNAC 1 cut(s) 58
Hpy188III TCNNGA 2 cut(s) 85, 199
Hpy8I GTNNAC 1 cut(s) 58
Hpy99I CGWCG 1 cut(s) 223
HpyCH4III ACNGT 1 cut(s) 82
HpyCH4V TGCA 4 cut(s) 42, 127, 234, 281
HpyF10VI GCNNNNNNNGC 1 cut(s) 287
Hsp92II CATG 1 cut(s) 46
Kzo9I GATC 1 cut(s) 314
LpnPI CCDG 1 cut(s) 264
MaeI CTAG 2 cut(s) 336, 375
MalI GATC 1 cut(s) 316
MboI GATC 1 cut(s) 314
MluCI AATT 4 cut(s) 92, 171, 224, 325
MnlI CCTC 3 cut(s) 20, 128, 263
MseI TTAA 1 cut(s) 95
MwoI GCNNNNNNNGC 1 cut(s) 287
NdeII GATC 1 cut(s) 314
NlaIII CATG 1 cut(s) 46
PfeI GAWTC 2 cut(s) 348, 365
PflMI CCANNNNNTGG 1 cut(s) 210
PpuMI RGGWCCY 1 cut(s) 248
PsiI TTATAA 1 cut(s) 258
Psp5II RGGWCCY 1 cut(s) 248
PspPI GGNCC 1 cut(s) 248
PspPPI RGGWCCY 1 cut(s) 248
SaqAI TTAA 1 cut(s) 95
Sau3AI GATC 1 cut(s) 314
Sau96I GGNCC 1 cut(s) 248
SetI ASST 9 cut(s) 12, 126, 197, 253, 274, 292, 298, 337, 380
SfcI CTRYAG 1 cut(s) 291
SgeI CNNG 9 cut(s) 55, 97, 121, 133, 211, 263, 299, 348, 387
SinI GGWCC 1 cut(s) 248
SmlI CTYRAG 1 cut(s) 119
SmoI CTYRAG 1 cut(s) 119
Sse9I AATT 4 cut(s) 92, 171, 224, 325
SspMI CTAG 2 cut(s) 336, 375
TaaI ACNGT 1 cut(s) 82
TasI AATT 4 cut(s) 92, 171, 224, 325
TfiI GAWTC 2 cut(s) 348, 365
Tru1I TTAA 1 cut(s) 95
Tru9I TTAA 1 cut(s) 95
TspDTI ATGAA 3 cut(s) 17, 105, 347
TspGWI ACGGA 2 cut(s) 75, 236
Van91I CCANNNNNTGG 1 cut(s) 210
VpaK11BI GGWCC 1 cut(s) 248
XapI RAATTY 1 cut(s) 224
XmiI GTMKAC 1 cut(s) 57
XspI CTAG 2 cut(s) 336, 375
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.