AT3G26860

Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Reverse (-)
9901294 .. 9902119
826 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G26860.2

Sequence Viewer

Length: 288 bp
ATGCAAAACCTCTCAATACTACTTGTGTGTAGCTTTTGCATACTTGGCCATGTATCTAGCGCTGGAATCAGGATTGGTAACGAACTCAAAAACAAAAAACTCTTATGGATGAGATGTTATTCCAAAGATGACGTTATAGGTCCATTAATAATACCGATCGGAGGGCATAGGTTCAATTATTTTGCATTTAAACTTTACAGTGCTTCAGATGATGGAGGCGTATGGGATTGGAGAGCAAGAGAAGATGGGATCTATCTAAAGATAAAAGCTGAGAGAGGTGTTAATTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

95

Amino Acids

10.76

Weight (kDa)

9.12

Isoelectric Point (pI)

15.67

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 23 - 113 4e-19 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 257
AcoI YGGCCR 1 cut(s) 46
AcuI CTGAAG 1 cut(s) 189
AfeI AGCGCT 1 cut(s) 61
AfiI CCNNNNNNNGG 1 cut(s) 161
AgsI TTSAA 1 cut(s) 175
AluBI AGCT 2 cut(s) 33, 269
AluI AGCT 2 cut(s) 33, 269
AlwI GGATC 1 cut(s) 257
Aor51HI AGCGCT 1 cut(s) 61
AoxI GGCC 1 cut(s) 46
AseI ATTAAT 1 cut(s) 146
AspLEI GCGC 1 cut(s) 62
AspS9I GGNCC 1 cut(s) 140
AvaII GGWCC 1 cut(s) 140
BalI TGGCCA 1 cut(s) 48
BccI CCATC 2 cut(s) 206, 239
BfaI CTAG 1 cut(s) 57
BfoI RGCGCY 1 cut(s) 63
Bme18I GGWCC 1 cut(s) 140
BmgT120I GGNCC 1 cut(s) 140
Bsc4I CCNNNNNNNGG 1 cut(s) 161
BseGI GGATG 1 cut(s) 114
BseLI CCNNNNNNNGG 1 cut(s) 161
BseMII CTCAG 1 cut(s) 261
Bsh1285I CGRYCG 1 cut(s) 159
BshFI GGCC 1 cut(s) 48
BsiEI CGRYCG 1 cut(s) 159
BslI CCNNNNNNNGG 1 cut(s) 161
BsnI GGCC 1 cut(s) 48
Bsp143I GATC 2 cut(s) 156, 249
BspANI GGCC 1 cut(s) 48
BspCNI CTCAG 1 cut(s) 262
BspPI GGATC 1 cut(s) 257
BssMI GATC 2 cut(s) 156, 249
Bst4CI ACNGT 1 cut(s) 200
BstDEI CTNAG 1 cut(s) 270
BstF5I GGATG 1 cut(s) 114
BstH2I RGCGCY 1 cut(s) 63
BstHHI GCGC 1 cut(s) 62
BstKTI GATC 2 cut(s) 159, 252
BstMBI GATC 2 cut(s) 156, 249
BstMCI CGRYCG 1 cut(s) 159
BstMWI GCNNNNNNNGC 1 cut(s) 45
BstX2I RGATCY 1 cut(s) 249
BstYI RGATCY 1 cut(s) 249
BsuRI GGCC 1 cut(s) 48
BtsCI GGATG 1 cut(s) 114
BtsIMutI CAGTG 1 cut(s) 205
CfoI GCGC 1 cut(s) 62
Cfr13I GGNCC 1 cut(s) 140
CviAII CATG 1 cut(s) 50
CviJI RGCY 3 cut(s) 33, 48, 269
CviKI_1 RGCY 3 cut(s) 33, 48, 269
DdeI CTNAG 1 cut(s) 270
DpnI GATC 2 cut(s) 158, 251
DpnII GATC 2 cut(s) 156, 249
DraI TTTAAA 1 cut(s) 190
EaeI YGGCCR 1 cut(s) 46
Eco47I GGWCC 1 cut(s) 140
Eco47III AGCGCT 1 cut(s) 61
Eco57I CTGAAG 1 cut(s) 189
FaeI CATG 1 cut(s) 53
FaiI YATR 6 cut(s) 41, 51, 106, 137, 168, 223
FatI CATG 1 cut(s) 49
FokI GGATG 1 cut(s) 121
FspBI CTAG 1 cut(s) 57
GlaI GCGC 1 cut(s) 61
HaeII RGCGCY 1 cut(s) 63
HaeIII GGCC 1 cut(s) 48
HhaI GCGC 1 cut(s) 62
Hin1II CATG 1 cut(s) 53
Hin6I GCGC 1 cut(s) 60
HinP1I GCGC 1 cut(s) 60
HinfI GANTC 1 cut(s) 66
Hpy188I TCNGA 2 cut(s) 161, 208
Hpy188III TCNNGA 1 cut(s) 70
HpyCH4III ACNGT 1 cut(s) 200
HpyCH4IV ACGT 1 cut(s) 132
HpyCH4V TGCA 3 cut(s) 4, 39, 185
HpyF10VI GCNNNNNNNGC 1 cut(s) 45
HpyF3I CTNAG 1 cut(s) 270
HpySE526I ACGT 1 cut(s) 132
Hsp92II CATG 1 cut(s) 53
HspAI GCGC 1 cut(s) 60
Kzo9I GATC 2 cut(s) 156, 249
LpnPI CCDG 2 cut(s) 48, 55
MaeI CTAG 1 cut(s) 57
MaeII ACGT 1 cut(s) 132
MaeIII GTNAC 1 cut(s) 77
MalI GATC 2 cut(s) 158, 251
MboI GATC 2 cut(s) 156, 249
MboII GAAGA 1 cut(s) 254
MflI RGATCY 1 cut(s) 249
MlsI TGGCCA 1 cut(s) 48
MluCI AATT 2 cut(s) 175, 283
MluNI TGGCCA 1 cut(s) 48
MnlI CCTC 4 cut(s) 20, 155, 209, 269
Mox20I TGGCCA 1 cut(s) 48
MscI TGGCCA 1 cut(s) 48
MseI TTAA 3 cut(s) 146, 189, 282
Msp20I TGGCCA 1 cut(s) 48
MwoI GCNNNNNNNGC 1 cut(s) 45
NdeII GATC 2 cut(s) 156, 249
NlaIII CATG 1 cut(s) 53
PfeI GAWTC 1 cut(s) 66
Ple19I CGATCG 1 cut(s) 159
PshBI ATTAAT 1 cut(s) 146
PspPI GGNCC 1 cut(s) 140
PsuI RGATCY 1 cut(s) 249
PvuI CGATCG 1 cut(s) 159
SaqAI TTAA 3 cut(s) 146, 189, 282
Sau3AI GATC 2 cut(s) 156, 249
Sau96I GGNCC 1 cut(s) 140
SetI ASST 7 cut(s) 12, 35, 135, 142, 173, 271, 280
SgeI CNNG 7 cut(s) 35, 56, 62, 69, 75, 82, 249
SinI GGWCC 1 cut(s) 140
Sse9I AATT 2 cut(s) 175, 283
SspMI CTAG 1 cut(s) 57
TaaI ACNGT 1 cut(s) 200
TaiI ACGT 1 cut(s) 135
TasI AATT 2 cut(s) 175, 283
TfiI GAWTC 1 cut(s) 66
Tru1I TTAA 3 cut(s) 146, 189, 282
Tru9I TTAA 3 cut(s) 146, 189, 282
TscAI CASTG 1 cut(s) 205
TspRI CASTG 1 cut(s) 205
VpaK11BI GGWCC 1 cut(s) 140
VspI ATTAAT 1 cut(s) 146
XspI CTAG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.