FvH4_3g38210

F-box LRR-repeat protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
OG0000586
Physical Location & Seq
Forward (+)
32625768 .. 32626100
333 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g38210.t1

Sequence Viewer

Length: 294 bp
ATGATTGATGATGAAGGTCCTAGGAGTAAAGATGACGATGCACTTGCTATAGCAGGGACGATGCATGGTTTAAACCACCTGGCGATTCTTGATGGTTGTCCTCATCTTGAGTCACTTGATCTTCGCTCTTGTTTTAATCTTAATCTGGAGGGAGATTTGGGCAGAAGATGCAGTGAACAAATTAAAACATTGTTGCTTCCTGGAGATTTGATTGCTAGACCTTCTACTGATTTTCCTCACGAATCACCTGAATATAATGGAGGCTGGGACTCGGACTCATCTGATGATTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box F-box-like LRR_6

Protein Analysis

98

Amino Acids

10.64

Weight (kDa)

4.27

Isoelectric Point (pI)

64.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 2 cut(s) 78, 199
AspA2I CCTAGG 1 cut(s) 20
AspS9I GGNCC 1 cut(s) 17
AsuHPI GGTGA 1 cut(s) 237
AvaII GGWCC 1 cut(s) 17
AvrII CCTAGG 1 cut(s) 20
BccI CCATC 1 cut(s) 86
BcgI CGANNNNNNTGC 2 cut(s) 26, 60
BciT130I CCWGG 2 cut(s) 80, 201
BfaI CTAG 2 cut(s) 21, 216
BfmI CTRYAG 1 cut(s) 48
BlnI CCTAGG 1 cut(s) 20
Bme1390I CCNGG 2 cut(s) 80, 201
Bme18I GGWCC 1 cut(s) 17
BmgT120I GGNCC 1 cut(s) 17
BmrFI CCNGG 2 cut(s) 80, 201
BmsI GCATC 3 cut(s) 28, 51, 158
BpmI CTGGAG 2 cut(s) 167, 222
BpuEI CTTGAG 1 cut(s) 128
BsaJI CCNNGG 1 cut(s) 20
BseBI CCWGG 2 cut(s) 80, 201
BseDI CCNNGG 1 cut(s) 20
BseYI CCCAGC 1 cut(s) 264
BslFI GGGAC 2 cut(s) 70, 281
BsmFI GGGAC 2 cut(s) 70, 281
Bsp143I GATC 1 cut(s) 118
BssECI CCNNGG 1 cut(s) 20
BssMI GATC 1 cut(s) 118
BssT1I CCWWGG 1 cut(s) 20
Bst2UI CCWGG 2 cut(s) 80, 201
BstAPI GCANNNNNTGC 1 cut(s) 168
BstKTI GATC 1 cut(s) 121
BstMBI GATC 1 cut(s) 118
BstMWI GCNNNNNNNGC 1 cut(s) 168
BstNI CCWGG 2 cut(s) 80, 201
BstSCI CCNGG 2 cut(s) 78, 199
BstSFI CTRYAG 1 cut(s) 48
BtsI GCAGTG 1 cut(s) 178
BtsIMutI CAGTG 1 cut(s) 178
Cfr13I GGNCC 1 cut(s) 17
CviAII CATG 1 cut(s) 65
CviJI RGCY 1 cut(s) 264
CviKI_1 RGCY 1 cut(s) 264
DpnI GATC 1 cut(s) 120
DpnII GATC 1 cut(s) 118
DraI TTTAAA 1 cut(s) 72
Eco130I CCWWGG 1 cut(s) 20
Eco47I GGWCC 1 cut(s) 17
EcoO109I RGGNCCY 1 cut(s) 17
EcoRII CCWGG 2 cut(s) 78, 199
EcoT14I CCWWGG 1 cut(s) 20
EcoT22I ATGCAT 1 cut(s) 66
ErhI CCWWGG 1 cut(s) 20
FaeI CATG 1 cut(s) 68
FaiI YATR 3 cut(s) 50, 66, 255
FaqI GGGAC 2 cut(s) 70, 281
FatI CATG 1 cut(s) 64
FspBI CTAG 2 cut(s) 21, 216
GsaI CCCAGC 1 cut(s) 268
GsuI CTGGAG 2 cut(s) 167, 222
Hin1II CATG 1 cut(s) 68
HinfI GANTC 5 cut(s) 85, 110, 242, 269, 275
HphI GGTGA 1 cut(s) 237
Hpy166II GTNNAC 1 cut(s) 176
Hpy188I TCNGA 2 cut(s) 274, 283
Hpy188III TCNNGA 4 cut(s) 89, 107, 146, 239
Hpy8I GTNNAC 1 cut(s) 176
HpyAV CCTTC 2 cut(s) 8, 231
HpyCH4V TGCA 3 cut(s) 41, 64, 171
HpyF10VI GCNNNNNNNGC 1 cut(s) 168
Hsp92II CATG 1 cut(s) 68
Kzo9I GATC 1 cut(s) 118
LpnPI CCDG 8 cut(s) 39, 65, 92, 131, 186, 213, 250, 261
LweI GCATC 3 cut(s) 28, 51, 158
MaeI CTAG 2 cut(s) 21, 216
MaeIII GTNAC 1 cut(s) 111
MalI GATC 1 cut(s) 120
MboI GATC 1 cut(s) 118
MboII GAAGA 2 cut(s) 113, 177
MluCI AATT 1 cut(s) 180
MlyI GAGTC 3 cut(s) 119, 263, 269
MnlI CCTC 4 cut(s) 111, 142, 246, 254
Mph1103I ATGCAT 1 cut(s) 66
MseI TTAA 4 cut(s) 71, 135, 141, 183
MspR9I CCNGG 2 cut(s) 80, 201
MssI GTTTAAAC 1 cut(s) 72
MvaI CCWGG 2 cut(s) 80, 201
MwoI GCNNNNNNNGC 1 cut(s) 168
NdeII GATC 1 cut(s) 118
NlaIII CATG 1 cut(s) 68
NmuCI GTSAC 1 cut(s) 111
NsiI ATGCAT 1 cut(s) 66
PfeI GAWTC 2 cut(s) 85, 242
PfoI TCCNGGA 1 cut(s) 199
PleI GAGTC 3 cut(s) 118, 263, 269
PmeI GTTTAAAC 1 cut(s) 72
PpsI GAGTC 3 cut(s) 118, 263, 269
PpuMI RGGWCCY 1 cut(s) 17
Psp5II RGGWCCY 1 cut(s) 17
Psp6I CCWGG 2 cut(s) 78, 199
PspFI CCCAGC 1 cut(s) 264
PspGI CCWGG 2 cut(s) 78, 199
PspPI GGNCC 1 cut(s) 17
PspPPI RGGWCCY 1 cut(s) 17
SaqAI TTAA 4 cut(s) 71, 135, 141, 183
Sau3AI GATC 1 cut(s) 118
Sau96I GGNCC 1 cut(s) 17
SchI GAGTC 3 cut(s) 119, 263, 269
ScrFI CCNGG 2 cut(s) 80, 201
SetI ASST 4 cut(s) 19, 81, 223, 250
SfaNI GCATC 3 cut(s) 28, 51, 158
SfcI CTRYAG 1 cut(s) 48
SinI GGWCC 1 cut(s) 17
SmlI CTYRAG 1 cut(s) 107
SmoI CTYRAG 1 cut(s) 107
Sse9I AATT 1 cut(s) 180
SspMI CTAG 2 cut(s) 21, 216
StyD4I CCNGG 2 cut(s) 78, 199
StyI CCWWGG 1 cut(s) 20
TasI AATT 1 cut(s) 180
TfiI GAWTC 2 cut(s) 85, 242
Tru1I TTAA 4 cut(s) 71, 135, 141, 183
Tru9I TTAA 4 cut(s) 71, 135, 141, 183
TscAI CASTG 1 cut(s) 178
TseFI GTSAC 1 cut(s) 111
Tsp45I GTSAC 1 cut(s) 111
TspDTI ATGAA 1 cut(s) 27
TspRI CASTG 1 cut(s) 178
VpaK11BI GGWCC 1 cut(s) 17
XmaJI CCTAGG 1 cut(s) 20
XspI CTAG 2 cut(s) 21, 216
Zsp2I ATGCAT 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.