Rh6DG501200

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
65717656 .. 65718656
1001 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG501200.1

Sequence Viewer

Length: 339 bp
ATGTGGCGCACCATCGACATGAGAAATGATGGTGATCTCCAAGCCATGGACTACGACTTGGAGGTTATGTGCCGTCACGACTTGCAAGAACAACACTTCGGCACCGATCGGTTGCTTCATTACATCACTGATAGTTCAAGGGGGATCAGACGCCTCCGACTATTGTGTTGCAATAGCATATCAGATGAGGGATTGGGAAAAGTGGCTCAGAAACTTCCATTGTTGGAGGAACTTGACATTTCTCTATGCGACGATTACAATGGAGTTGCATTTGCTATAGCAGGAACAATGGGTGGTTTACGCCACCTCCAGCTTTTCGGGAATAAGTTGACAAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

12.77

Weight (kDa)

5.45

Isoelectric Point (pI)

45.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 101
AccB7I CCANNNNNTGG 1 cut(s) 46
AclWI GGATC 1 cut(s) 152
AcyI GRCGYC 1 cut(s) 151
AfiI CCNNNNNNNGG 1 cut(s) 46
AgsI TTSAA 1 cut(s) 138
AluBI AGCT 1 cut(s) 313
AluI AGCT 1 cut(s) 313
AlwI GGATC 1 cut(s) 152
AspLEI GCGC 1 cut(s) 9
AsuHPI GGTGA 1 cut(s) 44
BanI GGYRCC 1 cut(s) 101
BccI CCATC 2 cut(s) 20, 23
BceAI ACGGC 1 cut(s) 57
BfmI CTRYAG 1 cut(s) 276
BmiI GGNNCC 1 cut(s) 103
BpmI CTGGAG 1 cut(s) 293
BsaBI GATNNNNATC 1 cut(s) 33
BsaHI GRCGYC 1 cut(s) 151
BsaJI CCNNGG 1 cut(s) 45
BsaXI ACNNNNNCTCC 4 cut(s) 53, 83, 291, 321
Bsc4I CCNNNNNNNGG 1 cut(s) 46
Bse8I GATNNNNATC 1 cut(s) 33
BseDI CCNNGG 1 cut(s) 45
BseJI GATNNNNATC 1 cut(s) 33
BseLI CCNNNNNNNGG 1 cut(s) 46
BseMII CTCAG 1 cut(s) 221
Bsh1285I CGRYCG 1 cut(s) 109
BshNI GGYRCC 1 cut(s) 101
BsiEI CGRYCG 1 cut(s) 109
BslI CCNNNNNNNGG 1 cut(s) 46
Bsp143I GATC 3 cut(s) 34, 106, 144
Bsp19I CCATGG 1 cut(s) 45
BspCNI CTCAG 1 cut(s) 220
BspLI GGNNCC 1 cut(s) 103
BspPI GGATC 1 cut(s) 152
BspT107I GGYRCC 1 cut(s) 101
BssECI CCNNGG 1 cut(s) 45
BssMI GATC 3 cut(s) 34, 106, 144
BssNI GRCGYC 1 cut(s) 151
BssT1I CCWWGG 1 cut(s) 45
BstACI GRCGYC 1 cut(s) 151
BstDEI CTNAG 1 cut(s) 207
BstDSI CCRYGG 1 cut(s) 45
BstHHI GCGC 1 cut(s) 9
BstKTI GATC 3 cut(s) 37, 109, 147
BstMBI GATC 3 cut(s) 34, 106, 144
BstMCI CGRYCG 1 cut(s) 109
BstSFI CTRYAG 1 cut(s) 276
BtgI CCRYGG 1 cut(s) 45
BtsIMutI CAGTG 1 cut(s) 126
CfoI GCGC 1 cut(s) 9
CseI GACGC 1 cut(s) 159
CviAII CATG 2 cut(s) 19, 46
CviJI RGCY 3 cut(s) 44, 206, 313
CviKI_1 RGCY 3 cut(s) 44, 206, 313
DdeI CTNAG 1 cut(s) 207
DpnI GATC 3 cut(s) 36, 108, 146
DpnII GATC 3 cut(s) 34, 106, 144
Eco130I CCWWGG 1 cut(s) 45
EcoT14I CCWWGG 1 cut(s) 45
ErhI CCWWGG 1 cut(s) 45
FaeI CATG 2 cut(s) 22, 49
FaiI YATR 6 cut(s) 20, 47, 68, 179, 247, 278
FatI CATG 2 cut(s) 18, 45
GlaI GCGC 1 cut(s) 8
GsuI CTGGAG 1 cut(s) 293
HgaI GACGC 1 cut(s) 159
HhaI GCGC 1 cut(s) 9
Hin1I GRCGYC 1 cut(s) 151
Hin1II CATG 2 cut(s) 22, 49
Hin6I GCGC 1 cut(s) 7
HinP1I GCGC 1 cut(s) 7
HincII GTYRAC 1 cut(s) 330
HindII GTYRAC 1 cut(s) 330
HphI GGTGA 1 cut(s) 44
Hpy166II GTNNAC 2 cut(s) 299, 330
Hpy188I TCNGA 4 cut(s) 149, 158, 184, 210
Hpy188III TCNNGA 2 cut(s) 77, 319
Hpy8I GTNNAC 2 cut(s) 299, 330
Hpy99I CGWCG 1 cut(s) 254
HpyCH4V TGCA 3 cut(s) 85, 171, 269
HpyF3I CTNAG 1 cut(s) 207
Hsp92I GRCGYC 1 cut(s) 151
Hsp92II CATG 2 cut(s) 22, 49
HspAI GCGC 1 cut(s) 7
Kzo9I GATC 3 cut(s) 34, 106, 144
LpnPI CCDG 2 cut(s) 267, 323
MaeIII GTNAC 1 cut(s) 74
MalI GATC 3 cut(s) 36, 108, 146
MboI GATC 3 cut(s) 34, 106, 144
MmeI TCCRAC 2 cut(s) 181, 204
MnlI CCTC 5 cut(s) 55, 164, 181, 220, 317
MslI CAYNNNNRTG 1 cut(s) 17
NcoI CCATGG 1 cut(s) 45
NdeII GATC 3 cut(s) 34, 106, 144
NlaIII CATG 2 cut(s) 22, 49
NlaIV GGNNCC 1 cut(s) 103
NmuCI GTSAC 1 cut(s) 74
PflMI CCANNNNNTGG 1 cut(s) 46
Ple19I CGATCG 1 cut(s) 109
PspN4I GGNNCC 1 cut(s) 103
PvuI CGATCG 1 cut(s) 109
RseI CAYNNNNRTG 1 cut(s) 17
Sau3AI GATC 3 cut(s) 34, 106, 144
SetI ASST 3 cut(s) 66, 309, 315
SfcI CTRYAG 1 cut(s) 276
SmiMI CAYNNNNRTG 1 cut(s) 17
StyI CCWWGG 1 cut(s) 45
TaqI TCGA 1 cut(s) 15
TscAI CASTG 1 cut(s) 133
TseFI GTSAC 1 cut(s) 74
Tsp45I GTSAC 1 cut(s) 74
TspDTI ATGAA 1 cut(s) 107
TspRI CASTG 1 cut(s) 133
Van91I CCANNNNNTGG 1 cut(s) 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.