Rmu_co8003450.1_g000001

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8003450.1
Physical Location & Seq
Forward (+)
1 .. 508
508 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8003450.1_g000001.1.cds

Sequence Viewer

Length: 508 bp
ttgtcctcatctttgttcacttgatctacgccactgtttcattcttaatctggatggagatttgggaagaatatgtgctgaacgaattgaaaaactgtggctgccacatgattctactgagggcaaagaatttgatgctagatctgaaggttactgctttaaatggacagagctcccagacaatattacaagatcaatactgtcacggctgggagcaattgagatcctggccactgctcagaaagtgtgctcaaagtggttctacatctgcaaggacccattgatgtggcgcaccatcgacatgcacaataagtttgatatttccaactacaggcccttctacttgcatgacttgtgtgaagatgccattgatcgtagctgtggtaatttggttgatatcaatgttgagaacttcggtaccaattttctcctagattatcttgcagagaggtatatcattctcactcatactaaaattcagatccttaatacttatcataatccgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

168

Amino Acids

19.69

Weight (kDa)

5.6

Isoelectric Point (pI)

52.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 417
AccB1I GGYRCC 1 cut(s) 417
AclWI GGATC 2 cut(s) 218, 476
AcoI YGGCCR 1 cut(s) 229
AcsI RAATTY 2 cut(s) 129, 475
AcuI CTGAAG 1 cut(s) 166
AfaI GTAC 1 cut(s) 419
AfiI CCNNNNNNNGG 1 cut(s) 331
AgsI TTSAA 1 cut(s) 90
AjnI CCWGG 1 cut(s) 226
AluBI AGCT 2 cut(s) 173, 379
AluI AGCT 2 cut(s) 173, 379
Alw21I GWGCWC 2 cut(s) 175, 252
AlwI GGATC 2 cut(s) 218, 476
AoxI GGCC 2 cut(s) 229, 333
ApeKI GCWGC 1 cut(s) 101
ApoI RAATTY 2 cut(s) 129, 475
Asp718I GGTACC 1 cut(s) 417
AspLEI GCGC 1 cut(s) 292
AspS9I GGNCC 2 cut(s) 275, 334
AvaII GGWCC 1 cut(s) 275
BaeI ACNNNNGTAYC 2 cut(s) 401, 434
BalI TGGCCA 1 cut(s) 231
BanI GGYRCC 1 cut(s) 417
BanII GRGCYC 1 cut(s) 175
Bbv12I GWGCWC 2 cut(s) 175, 252
BbvI GCAGC 1 cut(s) 88
BccI CCATC 2 cut(s) 48, 303
BceAI ACGGC 1 cut(s) 222
BciT130I CCWGG 1 cut(s) 228
BfaI CTAG 2 cut(s) 139, 432
BfmI CTRYAG 1 cut(s) 329
BglII AGATCT 1 cut(s) 141
BisI GCNGC 1 cut(s) 102
BlsI GCNGC 1 cut(s) 103
Bme1390I CCNGG 1 cut(s) 228
Bme18I GGWCC 1 cut(s) 275
BmgT120I GGNCC 2 cut(s) 275, 334
BmiI GGNNCC 2 cut(s) 277, 419
BmrFI CCNGG 1 cut(s) 228
BmsI GCATC 2 cut(s) 125, 353
Bsc4I CCNNNNNNNGG 1 cut(s) 331
BseBI CCWGG 1 cut(s) 228
BseGI GGATG 1 cut(s) 59
BseLI CCNNNNNNNGG 1 cut(s) 331
BseMII CTCAG 2 cut(s) 109, 252
BseXI GCAGC 1 cut(s) 88
BseYI CCCAGC 1 cut(s) 209
BshFI GGCC 2 cut(s) 231, 335
BshNI GGYRCC 1 cut(s) 417
BsiHKAI GWGCWC 2 cut(s) 175, 252
BslI CCNNNNNNNGG 1 cut(s) 331
BsnI GGCC 2 cut(s) 231, 335
Bsp1286I GDGCHC 2 cut(s) 175, 252
Bsp143I GATC 6 cut(s) 23, 141, 192, 223, 371, 481
BspANI GGCC 2 cut(s) 231, 335
BspCNI CTCAG 2 cut(s) 110, 251
BspLI GGNNCC 2 cut(s) 277, 419
BspPI GGATC 2 cut(s) 218, 476
BspT107I GGYRCC 1 cut(s) 417
BssMI GATC 6 cut(s) 23, 141, 192, 223, 371, 481
Bst2UI CCWGG 1 cut(s) 228
Bst4CI ACNGT 3 cut(s) 36, 97, 202
BstDEI CTNAG 2 cut(s) 118, 238
BstF5I GGATG 1 cut(s) 59
BstHHI GCGC 1 cut(s) 292
BstKTI GATC 6 cut(s) 26, 144, 195, 226, 374, 484
BstMBI GATC 6 cut(s) 23, 141, 192, 223, 371, 481
BstNI CCWGG 1 cut(s) 228
BstNSI RCATGY 1 cut(s) 305
BstSCI CCNGG 1 cut(s) 226
BstSFI CTRYAG 1 cut(s) 329
BstV1I GCAGC 1 cut(s) 88
BstX2I RGATCY 3 cut(s) 141, 223, 481
BstXI CCANNNNNNTGG 1 cut(s) 286
BstYI RGATCY 3 cut(s) 141, 223, 481
BsuRI GGCC 2 cut(s) 231, 335
BtsCI GGATG 1 cut(s) 59
BtsI GCAGTG 1 cut(s) 232
BtsIMutI CAGTG 2 cut(s) 32, 232
CfoI GCGC 1 cut(s) 292
Cfr13I GGNCC 2 cut(s) 275, 334
Csp6I GTAC 1 cut(s) 418
CviAII CATG 3 cut(s) 108, 302, 348
CviJI RGCY 6 cut(s) 101, 173, 209, 231, 335, 379
CviKI_1 RGCY 6 cut(s) 101, 173, 209, 231, 335, 379
CviQI GTAC 1 cut(s) 418
DdeI CTNAG 2 cut(s) 118, 238
DpnI GATC 6 cut(s) 25, 143, 194, 225, 373, 483
DpnII GATC 6 cut(s) 23, 141, 192, 223, 371, 481
DraI TTTAAA 1 cut(s) 161
EaeI YGGCCR 1 cut(s) 229
Ecl136II GAGCTC 1 cut(s) 173
Eco24I GRGCYC 1 cut(s) 175
Eco32I GATATC 1 cut(s) 398
Eco47I GGWCC 1 cut(s) 275
Eco53kI GAGCTC 1 cut(s) 173
Eco57I CTGAAG 1 cut(s) 166
EcoICRI GAGCTC 1 cut(s) 173
EcoO109I RGGNCCY 2 cut(s) 275, 334
EcoRII CCWGG 1 cut(s) 226
EcoRV GATATC 1 cut(s) 398
EcoT38I GRGCYC 1 cut(s) 175
FaeI CATG 3 cut(s) 111, 305, 351
FaiI YATR 7 cut(s) 74, 109, 303, 349, 454, 469, 499
FatI CATG 3 cut(s) 107, 301, 347
Fnu4HI GCNGC 1 cut(s) 102
FokI GGATG 1 cut(s) 66
FriOI GRGCYC 1 cut(s) 175
Fsp4HI GCNGC 1 cut(s) 102
FspBI CTAG 2 cut(s) 139, 432
GlaI GCGC 1 cut(s) 291
GluI GCNGC 1 cut(s) 102
GsaI CCCAGC 1 cut(s) 213
HaeIII GGCC 2 cut(s) 231, 335
HhaI GCGC 1 cut(s) 292
Hin1II CATG 3 cut(s) 111, 305, 351
Hin6I GCGC 1 cut(s) 290
HinP1I GCGC 1 cut(s) 290
HinfI GANTC 1 cut(s) 111
Hpy166II GTNNAC 1 cut(s) 18
Hpy188I TCNGA 3 cut(s) 146, 241, 481
Hpy188III TCNNGA 1 cut(s) 51
Hpy8I GTNNAC 1 cut(s) 18
HpyAV CCTTC 2 cut(s) 141, 347
HpyCH4III ACNGT 3 cut(s) 36, 97, 202
HpyCH4V TGCA 4 cut(s) 271, 305, 347, 444
HpyF3I CTNAG 2 cut(s) 118, 238
Hsp92II CATG 3 cut(s) 111, 305, 351
HspAI GCGC 1 cut(s) 290
KpnI GGTACC 1 cut(s) 421
Kzo9I GATC 6 cut(s) 23, 141, 192, 223, 371, 481
LmnI GCTCC 2 cut(s) 178, 213
LpnPI CCDG 6 cut(s) 36, 190, 195, 213, 240, 317
Lsp1109I GCAGC 1 cut(s) 88
LweI GCATC 2 cut(s) 125, 353
MaeI CTAG 2 cut(s) 139, 432
MaeIII GTNAC 2 cut(s) 150, 202
MalI GATC 6 cut(s) 25, 143, 194, 225, 373, 483
MboI GATC 6 cut(s) 23, 141, 192, 223, 371, 481
MboII GAAGA 2 cut(s) 79, 372
MfeI CAATTG 1 cut(s) 217
MflI RGATCY 3 cut(s) 141, 223, 481
MhlI GDGCHC 2 cut(s) 175, 252
MlsI TGGCCA 1 cut(s) 231
MluCI AATT 6 cut(s) 85, 129, 217, 386, 422, 475
MluNI TGGCCA 1 cut(s) 231
MmeI TCCRAC 1 cut(s) 349
MnlI CCTC 3 cut(s) 16, 113, 442
Mox20I TGGCCA 1 cut(s) 231
MscI TGGCCA 1 cut(s) 231
MseI TTAA 3 cut(s) 46, 160, 487
MslI CAYNNNNRTG 2 cut(s) 284, 300
Msp20I TGGCCA 1 cut(s) 231
MspR9I CCNGG 1 cut(s) 228
MunI CAATTG 1 cut(s) 217
MvaI CCWGG 1 cut(s) 228
NdeII GATC 6 cut(s) 23, 141, 192, 223, 371, 481
NlaIII CATG 3 cut(s) 111, 305, 351
NlaIV GGNNCC 2 cut(s) 277, 419
NmuCI GTSAC 1 cut(s) 202
NspI RCATGY 1 cut(s) 305
PfeI GAWTC 1 cut(s) 111
PkrI GCNGC 1 cut(s) 103
PpuMI RGGWCCY 1 cut(s) 275
Psp124BI GAGCTC 1 cut(s) 175
Psp5II RGGWCCY 1 cut(s) 275
Psp6I CCWGG 1 cut(s) 226
PspFI CCCAGC 1 cut(s) 209
PspGI CCWGG 1 cut(s) 226
PspN4I GGNNCC 2 cut(s) 277, 419
PspPI GGNCC 2 cut(s) 275, 334
PspPPI RGGWCCY 1 cut(s) 275
PsuI RGATCY 3 cut(s) 141, 223, 481
RsaI GTAC 1 cut(s) 419
RsaNI GTAC 1 cut(s) 418
RseI CAYNNNNRTG 2 cut(s) 284, 300
SacI GAGCTC 1 cut(s) 175
SaqAI TTAA 3 cut(s) 46, 160, 487
SatI GCNGC 1 cut(s) 102
Sau3AI GATC 6 cut(s) 23, 141, 192, 223, 371, 481
Sau96I GGNCC 2 cut(s) 275, 334
ScrFI CCNGG 1 cut(s) 228
SduI GDGCHC 2 cut(s) 175, 252
SetI ASST 4 cut(s) 152, 175, 381, 453
SfaNI GCATC 2 cut(s) 125, 353
SfcI CTRYAG 1 cut(s) 329
SinI GGWCC 1 cut(s) 275
SmiMI CAYNNNNRTG 2 cut(s) 284, 300
Sse9I AATT 6 cut(s) 85, 129, 217, 386, 422, 475
SspI AATATT 1 cut(s) 185
SspMI CTAG 2 cut(s) 139, 432
SstI GAGCTC 1 cut(s) 175
StyD4I CCNGG 1 cut(s) 226
TaaI ACNGT 3 cut(s) 36, 97, 202
TaqI TCGA 1 cut(s) 298
TasI AATT 6 cut(s) 85, 129, 217, 386, 422, 475
TfiI GAWTC 1 cut(s) 111
Tru1I TTAA 3 cut(s) 46, 160, 487
Tru9I TTAA 3 cut(s) 46, 160, 487
TscAI CASTG 2 cut(s) 39, 239
TseFI GTSAC 1 cut(s) 202
TseI GCWGC 1 cut(s) 101
Tsp45I GTSAC 1 cut(s) 202
TspDTI ATGAA 1 cut(s) 29
TspGWI ACGGA 1 cut(s) 493
TspRI CASTG 2 cut(s) 39, 239
VpaK11BI GGWCC 1 cut(s) 275
XapI RAATTY 2 cut(s) 129, 475
XceI RCATGY 1 cut(s) 305
XspI CTAG 2 cut(s) 139, 432
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.