Rmu_co8369503.1_g000001

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8369503.1
Physical Location & Seq
Reverse (-)
244 .. 651
408 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8369503.1_g000001.1.cds

Sequence Viewer

Length: 408 bp
atgttggagcaccttgacattacattattcgaggatatctcacatgaaactctagcattggttgggcgatcatgccctcttttgaaatcattcaagtttaacaaacaatggttcagagatgactgctgcgataaggctgagcgtaatgactgtgcatttgctatagcaggaaccatgcacgggttacaccacctcatgcttttcaggaatcaactgtctaacaaaggtttgtctgcaattcttgatggctgtcctcatcttgagtcactagatctacgacagtgtttcaatcttaaattgtggggaaagacgggtagaaggtgtgctgaacgaattcaaaagttgtggcttccccaggactccatcgacgacattgacccatcatatgatctggatgctgaatggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

135

Amino Acids

15.62

Weight (kDa)

5.61

Isoelectric Point (pI)

44.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 333
AfiI CCNNNNNNNGG 1 cut(s) 180
AgsI TTSAA 4 cut(s) 85, 94, 289, 338
AjnI CCWGG 1 cut(s) 354
Alw21I GWGCWC 1 cut(s) 12
ApeKI GCWGC 1 cut(s) 126
ApoI RAATTY 1 cut(s) 333
ArsI GACNNNNNNTTYG 2 cut(s) 140, 172
Asp700I GAANNNNTTC 2 cut(s) 89, 333
Bbv12I GWGCWC 1 cut(s) 12
BbvI GCAGC 1 cut(s) 113
BccI CCATC 3 cut(s) 239, 371, 388
BciT130I CCWGG 1 cut(s) 356
BfaI CTAG 2 cut(s) 53, 269
BfmI CTRYAG 1 cut(s) 162
BglII AGATCT 1 cut(s) 271
BisI GCNGC 1 cut(s) 127
BlpI GCTNAGC 1 cut(s) 138
BlsI GCNGC 1 cut(s) 128
Bme1390I CCNGG 1 cut(s) 356
BmiI GGNNCC 1 cut(s) 172
BmrFI CCNGG 1 cut(s) 356
BmsI GCATC 1 cut(s) 385
BplI GAGNNNNNCTC 2 cut(s) 23, 55
Bpu1102I GCTNAGC 1 cut(s) 138
BpuEI CTTGAG 1 cut(s) 281
BsaJI CCNNGG 1 cut(s) 354
Bsc4I CCNNNNNNNGG 1 cut(s) 180
BseBI CCWGG 1 cut(s) 356
BseDI CCNNGG 1 cut(s) 354
BseGI GGATG 1 cut(s) 400
BseLI CCNNNNNNNGG 1 cut(s) 180
BseMII CTCAG 1 cut(s) 129
BseXI GCAGC 1 cut(s) 113
BsiHKAI GWGCWC 1 cut(s) 12
BslI CCNNNNNNNGG 1 cut(s) 180
Bsp1286I GDGCHC 1 cut(s) 12
Bsp143I GATC 3 cut(s) 68, 271, 388
Bsp1720I GCTNAGC 1 cut(s) 138
BspCNI CTCAG 1 cut(s) 130
BspLI GGNNCC 1 cut(s) 172
BssECI CCNNGG 1 cut(s) 354
BssMI GATC 3 cut(s) 68, 271, 388
Bst2UI CCWGG 1 cut(s) 356
Bst4CI ACNGT 3 cut(s) 152, 216, 282
BstDEI CTNAG 1 cut(s) 138
BstF5I GGATG 1 cut(s) 400
BstKTI GATC 3 cut(s) 71, 274, 391
BstMBI GATC 3 cut(s) 68, 271, 388
BstNI CCWGG 1 cut(s) 356
BstSCI CCNGG 1 cut(s) 354
BstSFI CTRYAG 1 cut(s) 162
BstV1I GCAGC 1 cut(s) 113
BstX2I RGATCY 1 cut(s) 271
BstYI RGATCY 1 cut(s) 271
BtsCI GGATG 1 cut(s) 400
BtsIMutI CAGTG 1 cut(s) 287
CspCI CAANNNNNGTGG 2 cut(s) 326, 361
CviAII CATG 4 cut(s) 44, 72, 175, 196
CviJI RGCY 3 cut(s) 137, 249, 349
CviKI_1 RGCY 3 cut(s) 137, 249, 349
DdeI CTNAG 1 cut(s) 138
DpnI GATC 3 cut(s) 70, 273, 390
DpnII GATC 3 cut(s) 68, 271, 388
Eco32I GATATC 1 cut(s) 37
EcoRI GAATTC 1 cut(s) 333
EcoRII CCWGG 1 cut(s) 354
EcoRV GATATC 1 cut(s) 37
FaeI CATG 4 cut(s) 47, 75, 178, 199
FaiI YATR 7 cut(s) 45, 73, 164, 176, 197, 385, 387
FatI CATG 4 cut(s) 43, 71, 174, 195
FauNDI CATATG 1 cut(s) 385
Fnu4HI GCNGC 1 cut(s) 127
Fsp4HI GCNGC 1 cut(s) 127
FspBI CTAG 2 cut(s) 53, 269
GluI GCNGC 1 cut(s) 127
Hin1II CATG 4 cut(s) 47, 75, 178, 199
HinfI GANTC 3 cut(s) 208, 263, 359
Hpy188I TCNGA 1 cut(s) 116
Hpy188III TCNNGA 4 cut(s) 205, 242, 260, 392
Hpy99I CGWCG 1 cut(s) 371
HpyAV CCTTC 1 cut(s) 312
HpyCH4III ACNGT 3 cut(s) 152, 216, 282
HpyCH4V TGCA 3 cut(s) 155, 178, 236
HpyF3I CTNAG 1 cut(s) 138
Hsp92II CATG 4 cut(s) 47, 75, 178, 199
Kzo9I GATC 3 cut(s) 68, 271, 388
LmnI GCTCC 1 cut(s) 7
LpnPI CCDG 5 cut(s) 153, 190, 341, 368, 377
Lsp1109I GCAGC 1 cut(s) 113
LweI GCATC 1 cut(s) 385
MaeI CTAG 2 cut(s) 53, 269
MaeIII GTNAC 2 cut(s) 183, 264
MalI GATC 3 cut(s) 70, 273, 390
MboI GATC 3 cut(s) 68, 271, 388
MflI RGATCY 1 cut(s) 271
MhlI GDGCHC 1 cut(s) 12
MluCI AATT 3 cut(s) 237, 296, 333
MlyI GAGTC 2 cut(s) 272, 353
MnlI CCTC 4 cut(s) 25, 87, 203, 264
MroXI GAANNNNTTC 2 cut(s) 89, 333
MseI TTAA 2 cut(s) 99, 294
MspR9I CCNGG 1 cut(s) 356
MvaI CCWGG 1 cut(s) 356
NdeI CATATG 1 cut(s) 385
NdeII GATC 3 cut(s) 68, 271, 388
NlaIII CATG 4 cut(s) 47, 75, 178, 199
NlaIV GGNNCC 1 cut(s) 172
NmuCI GTSAC 1 cut(s) 264
PdmI GAANNNNTTC 2 cut(s) 89, 333
PfeI GAWTC 1 cut(s) 208
PkrI GCNGC 1 cut(s) 128
PleI GAGTC 2 cut(s) 271, 353
PpsI GAGTC 2 cut(s) 271, 353
Psp6I CCWGG 1 cut(s) 354
PspGI CCWGG 1 cut(s) 354
PspN4I GGNNCC 1 cut(s) 172
PsuI RGATCY 1 cut(s) 271
SaqAI TTAA 2 cut(s) 99, 294
SatI GCNGC 1 cut(s) 127
Sau3AI GATC 3 cut(s) 68, 271, 388
SchI GAGTC 2 cut(s) 272, 353
ScrFI CCNGG 1 cut(s) 356
SduI GDGCHC 1 cut(s) 12
SetI ASST 4 cut(s) 15, 195, 229, 323
SfaNI GCATC 1 cut(s) 385
SfcI CTRYAG 1 cut(s) 162
SmlI CTYRAG 1 cut(s) 260
SmoI CTYRAG 1 cut(s) 260
Sse9I AATT 3 cut(s) 237, 296, 333
SspMI CTAG 2 cut(s) 53, 269
StyD4I CCNGG 1 cut(s) 354
TaaI ACNGT 3 cut(s) 152, 216, 282
TaqI TCGA 2 cut(s) 30, 366
TasI AATT 3 cut(s) 237, 296, 333
TfiI GAWTC 1 cut(s) 208
Tru1I TTAA 2 cut(s) 99, 294
Tru9I TTAA 2 cut(s) 99, 294
TscAI CASTG 1 cut(s) 287
TseFI GTSAC 1 cut(s) 264
TseI GCWGC 1 cut(s) 126
Tsp45I GTSAC 1 cut(s) 264
TspDTI ATGAA 1 cut(s) 60
TspRI CASTG 1 cut(s) 287
XapI RAATTY 1 cut(s) 333
XmnI GAANNNNTTC 2 cut(s) 89, 333
XspI CTAG 2 cut(s) 53, 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.