FvH4_4g05353

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0000756
Physical Location & Seq
Reverse (-)
4659960 .. 4660569
610 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g05353.t1

Sequence Viewer

Length: 465 bp
ATGCTTAAAAAAGAAGGGTTCACATGGAGTCCAGCTTCTGAAATGGCTTTTGAAAGATTGAAAGTAGCTTTGACCACTACACCTGTTTTAGCTATTCCTGATTTTTCCAAGGAGTTTGTGGTGGAGTGTAATGCTTCAGATTTAGGCATTGGGGCGATATTGTCACAAGATGGCCACCCTATTGCATTTATGAGTAAGGCTTTGGCTCAAAGGCATTTGGCCATGTCTGTATATGATAAGGAAATGCTAGCAGTGGTATCAGCAGTGCAACATTGGAGACCCTATCTTTTGGGGCATCGTTTCAAGATTCTATCAGACCACAGGACCATTGAGTACTTCTTAAATCAAAGAATAACCACACCAGCTCAACAGAAGTGGCTTATCAAGCTGATGGGGTACTTCGTGGAGCAAGATAATGCAAATATGTGCTCAAGTGATACAAGCAAGGCTTCCAATACGAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVP_2 RVT_1 Retrotrans_gag rve

Protein Analysis

155

Amino Acids

17.4

Weight (kDa)

8.55

Isoelectric Point (pI)

33.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RT_RNaseH_2 PF17919 9 - 103 3.7e-31 RNase H-like domain found in reverse transcriptase
RT_RNaseH PF17917 34 - 133 1.1e-30 RNase H-like domain found in reverse transcriptase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 2 cut(s) 172, 219
AcuI CTGAAG 1 cut(s) 120
AfaI GTAC 2 cut(s) 335, 398
AgsI TTSAA 3 cut(s) 53, 61, 304
AluBI AGCT 5 cut(s) 35, 68, 92, 365, 388
AluI AGCT 5 cut(s) 35, 68, 92, 365, 388
Alw21I GWGCWC 1 cut(s) 431
Alw26I GTCTC 1 cut(s) 271
AlwNI CAGNNNCTG 1 cut(s) 38
AoxI GGCC 2 cut(s) 172, 219
AspS9I GGNCC 1 cut(s) 324
AsuNHI GCTAGC 1 cut(s) 247
AvaII GGWCC 1 cut(s) 324
BalI TGGCCA 2 cut(s) 174, 221
Bbv12I GWGCWC 1 cut(s) 431
BccI CCATC 2 cut(s) 164, 385
BcoDI GTCTC 1 cut(s) 271
BfaI CTAG 1 cut(s) 248
BmcAI AGTACT 1 cut(s) 335
Bme18I GGWCC 1 cut(s) 324
BmgT120I GGNCC 1 cut(s) 324
BmsI GCATC 1 cut(s) 304
BmtI GCTAGC 1 cut(s) 251
BpuEI CTTGAG 1 cut(s) 415
BsaI GGTCTC 1 cut(s) 271
BsaJI CCNNGG 1 cut(s) 108
BseDI CCNNGG 1 cut(s) 108
BshFI GGCC 2 cut(s) 174, 221
BsiHKAI GWGCWC 1 cut(s) 431
BsmAI GTCTC 1 cut(s) 271
BsnI GGCC 2 cut(s) 174, 221
Bso31I GGTCTC 1 cut(s) 271
Bsp1286I GDGCHC 1 cut(s) 431
BspANI GGCC 2 cut(s) 174, 221
BspOI GCTAGC 1 cut(s) 251
BspTNI GGTCTC 1 cut(s) 271
BssECI CCNNGG 1 cut(s) 108
BssT1I CCWWGG 1 cut(s) 108
BstC8I GCNNGC 1 cut(s) 249
BstMAI GTCTC 1 cut(s) 271
BstMWI GCNNNNNNNGC 1 cut(s) 385
BsuRI GGCC 2 cut(s) 174, 221
BtsI GCAGTG 2 cut(s) 258, 270
BtsIMutI CAGTG 2 cut(s) 258, 270
Cac8I GCNNGC 1 cut(s) 249
CaiI CAGNNNCTG 1 cut(s) 38
Cfr13I GGNCC 1 cut(s) 324
Csp6I GTAC 2 cut(s) 334, 397
CspCI CAANNNNNGTGG 2 cut(s) 356, 391
CviAII CATG 2 cut(s) 24, 223
CviQI GTAC 2 cut(s) 334, 397
EaeI YGGCCR 2 cut(s) 172, 219
Eco130I CCWWGG 1 cut(s) 108
Eco31I GGTCTC 1 cut(s) 271
Eco47I GGWCC 1 cut(s) 324
Eco57I CTGAAG 1 cut(s) 120
EcoT14I CCWWGG 1 cut(s) 108
ErhI CCWWGG 1 cut(s) 108
FaeI CATG 2 cut(s) 27, 226
FaiI YATR 6 cut(s) 25, 191, 224, 232, 234, 425
FalI AAGNNNNNCTT 2 cut(s) 433, 465
FatI CATG 2 cut(s) 23, 222
FspBI CTAG 1 cut(s) 248
HaeIII GGCC 2 cut(s) 174, 221
Hin1II CATG 2 cut(s) 27, 226
HinfI GANTC 2 cut(s) 28, 307
Hpy166II GTNNAC 1 cut(s) 21
Hpy188I TCNGA 3 cut(s) 40, 139, 316
Hpy188III TCNNGA 2 cut(s) 98, 304
Hpy8I GTNNAC 1 cut(s) 21
HpyAV CCTTC 1 cut(s) 8
HpyCH4V TGCA 3 cut(s) 185, 268, 419
HpyF10VI GCNNNNNNNGC 1 cut(s) 385
Hsp92II CATG 2 cut(s) 27, 226
LmnI GCTCC 1 cut(s) 406
LpnPI CCDG 5 cut(s) 45, 96, 111, 307, 375
LweI GCATC 1 cut(s) 304
MaeI CTAG 1 cut(s) 248
MaeIII GTNAC 1 cut(s) 162
MhlI GDGCHC 1 cut(s) 431
MlsI TGGCCA 2 cut(s) 174, 221
MluNI TGGCCA 2 cut(s) 174, 221
MlyI GAGTC 1 cut(s) 37
Mox20I TGGCCA 2 cut(s) 174, 221
MscI TGGCCA 2 cut(s) 174, 221
MseI TTAA 2 cut(s) 6, 341
Msp20I TGGCCA 2 cut(s) 174, 221
MwoI GCNNNNNNNGC 1 cut(s) 385
NheI GCTAGC 1 cut(s) 247
NlaIII CATG 2 cut(s) 27, 226
NmuCI GTSAC 1 cut(s) 162
PfeI GAWTC 1 cut(s) 307
PleI GAGTC 1 cut(s) 36
PpsI GAGTC 1 cut(s) 36
PspPI GGNCC 1 cut(s) 324
PstNI CAGNNNCTG 1 cut(s) 38
RsaI GTAC 2 cut(s) 335, 398
RsaNI GTAC 2 cut(s) 334, 397
SaqAI TTAA 2 cut(s) 6, 341
Sau96I GGNCC 1 cut(s) 324
ScaI AGTACT 1 cut(s) 335
SchI GAGTC 1 cut(s) 37
SduI GDGCHC 1 cut(s) 431
SetI ASST 6 cut(s) 37, 70, 85, 94, 367, 390
SfaNI GCATC 1 cut(s) 304
SinI GGWCC 1 cut(s) 324
SmlI CTYRAG 1 cut(s) 430
SmoI CTYRAG 1 cut(s) 430
SspMI CTAG 1 cut(s) 248
StyI CCWWGG 1 cut(s) 108
TatI WGTACW 1 cut(s) 333
TfiI GAWTC 1 cut(s) 307
Tru1I TTAA 2 cut(s) 6, 341
Tru9I TTAA 2 cut(s) 6, 341
TscAI CASTG 2 cut(s) 258, 270
TseFI GTSAC 1 cut(s) 162
Tsp45I GTSAC 1 cut(s) 162
TspRI CASTG 2 cut(s) 258, 270
VpaK11BI GGWCC 1 cut(s) 324
XcmI CCANNNNNNNNNTGG 1 cut(s) 115
XspI CTAG 1 cut(s) 248
ZrmI AGTACT 1 cut(s) 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.