RLG00000030464

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Forward (+)
62081094 .. 62081854
761 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000030464

Sequence Viewer

Length: 570 bp
ATGGAAGAGCCTTATTTGACAGTGCAGGTAATTGGAGATGTTCAAAATCCCATAACTATGCAATTGAAAGGGAGACTTAATAATAGGGAAGTGCGTGTTTTAATTGATGGTGGGGCAACACATTCATTCTTCCATCCATGTGTGTTAAAGAAAATAAGAGCTCAGGTAGATGATTCAAAATTATTGAAGGTAGTTGTGGCTTGTGGAATGCCCTCTCGGACTTCTGGAAAACTACAATTACAGATGGAGTTACAAGGTACTACCATTGACACTGAGGTGTTTGTTCTTCCCGTAAATGGTTGTGAGGTCCTCCTAGGGGCTTCTTGGCTTAAAACATTGGGTGATATAGTGTGGAACTTTGAGAAGATGACTATGAAGTTTACTATTGGTGATCAGAGTAATTTTTTACAAGGGTTGCTATCGGGTGACACGACTATGGTTAATAGCACCACAATGACAAATTTACTTCAACAAGAAAAGGAGGCTATGTTCATACAACTTATAGAAGTAACAGATCAATTGGAATTACAGCACAACCTACATCTACACTTTGCTGCATTAATCAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

190

Amino Acids

21.16

Weight (kDa)

5.49

Isoelectric Point (pI)

29.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
gag-asp_proteas PF13975 23 - 111 7e-09 gag-polyprotein putative aspartyl protease
Asp_protease_2 PF13650 23 - 109 9.7e-06 Aspartyl protease
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 16
AcsI RAATTY 1 cut(s) 460
AfaI GTAC 1 cut(s) 259
AfiI CCNNNNNNNGG 2 cut(s) 296, 316
AgsI TTSAA 5 cut(s) 44, 67, 177, 187, 470
AleI CACNNNNGTG 1 cut(s) 275
AloI GAACNNNNNNTCC 2 cut(s) 473, 505
AluBI AGCT 1 cut(s) 161
AluI AGCT 1 cut(s) 161
Alw21I GWGCWC 1 cut(s) 163
Alw26I GTCTC 1 cut(s) 67
ApeKI GCWGC 1 cut(s) 554
ApoI RAATTY 1 cut(s) 460
AseI ATTAAT 1 cut(s) 560
AspA2I CCTAGG 1 cut(s) 313
AspS9I GGNCC 1 cut(s) 307
AsuHPI GGTGA 3 cut(s) 353, 401, 437
AvaII GGWCC 1 cut(s) 307
AvrII CCTAGG 1 cut(s) 313
BanII GRGCYC 1 cut(s) 163
Bbv12I GWGCWC 1 cut(s) 163
BbvI GCAGC 1 cut(s) 541
BccI CCATC 3 cut(s) 101, 141, 238
BclI TGATCA 1 cut(s) 391
BcoDI GTCTC 1 cut(s) 67
BfaI CTAG 1 cut(s) 314
BfuAI ACCTGC 1 cut(s) 16
BisI GCNGC 1 cut(s) 555
BlnI CCTAGG 1 cut(s) 313
BlsI GCNGC 1 cut(s) 556
Bme18I GGWCC 1 cut(s) 307
BmgT120I GGNCC 1 cut(s) 307
Bpu10I CCTNAGC 1 cut(s) 162
BsaJI CCNNGG 1 cut(s) 313
BsaXI ACNNNNNCTCC 2 cut(s) 473, 503
Bsc4I CCNNNNNNNGG 2 cut(s) 296, 316
BseDI CCNNGG 1 cut(s) 313
BseGI GGATG 1 cut(s) 133
BseLI CCNNNNNNNGG 2 cut(s) 296, 316
BseMII CTCAG 2 cut(s) 176, 264
BseXI GCAGC 1 cut(s) 541
BsgI GTGCAG 1 cut(s) 44
BsiHKAI GWGCWC 1 cut(s) 163
BslI CCNNNNNNNGG 2 cut(s) 296, 316
BsmAI GTCTC 1 cut(s) 67
BsmI GAATGC 1 cut(s) 213
Bsp1286I GDGCHC 1 cut(s) 163
Bsp143I GATC 2 cut(s) 391, 514
BspCNI CTCAG 2 cut(s) 175, 265
BspMI ACCTGC 1 cut(s) 16
BssECI CCNNGG 1 cut(s) 313
BssMI GATC 2 cut(s) 391, 514
BssT1I CCWWGG 1 cut(s) 313
Bst4CI ACNGT 1 cut(s) 22
BstDEI CTNAG 2 cut(s) 162, 273
BstF5I GGATG 1 cut(s) 133
BstKTI GATC 2 cut(s) 394, 517
BstMAI GTCTC 1 cut(s) 67
BstMBI GATC 2 cut(s) 391, 514
BstV1I GCAGC 1 cut(s) 541
BtsCI GGATG 1 cut(s) 133
BtsIMutI CAGTG 2 cut(s) 27, 270
BveI ACCTGC 1 cut(s) 16
Cfr13I GGNCC 1 cut(s) 307
Csp6I GTAC 1 cut(s) 258
CviAII CATG 1 cut(s) 138
CviJI RGCY 6 cut(s) 10, 161, 200, 320, 328, 485
CviKI_1 RGCY 6 cut(s) 10, 161, 200, 320, 328, 485
CviQI GTAC 1 cut(s) 258
DdeI CTNAG 2 cut(s) 162, 273
DpnI GATC 2 cut(s) 393, 516
DpnII GATC 2 cut(s) 391, 514
Ecl136II GAGCTC 1 cut(s) 161
Eco130I CCWWGG 1 cut(s) 313
Eco24I GRGCYC 1 cut(s) 163
Eco47I GGWCC 1 cut(s) 307
Eco53kI GAGCTC 1 cut(s) 161
EcoICRI GAGCTC 1 cut(s) 161
EcoO109I RGGNCCY 1 cut(s) 307
EcoT14I CCWWGG 1 cut(s) 313
EcoT38I GRGCYC 1 cut(s) 163
ErhI CCWWGG 1 cut(s) 313
FaeI CATG 1 cut(s) 141
FaiI YATR 9 cut(s) 53, 59, 139, 347, 374, 437, 488, 494, 503
FalI AAGNNNNNCTT 2 cut(s) 60, 92
FatI CATG 1 cut(s) 137
FbaI TGATCA 1 cut(s) 391
Fnu4HI GCNGC 1 cut(s) 555
FokI GGATG 1 cut(s) 120
FriOI GRGCYC 1 cut(s) 163
Fsp4HI GCNGC 1 cut(s) 555
FspBI CTAG 1 cut(s) 314
GluI GCNGC 1 cut(s) 555
Hin1II CATG 1 cut(s) 141
HinfI GANTC 1 cut(s) 173
HphI GGTGA 3 cut(s) 353, 401, 437
Hpy166II GTNNAC 1 cut(s) 381
Hpy188I TCNGA 2 cut(s) 219, 396
Hpy188III TCNNGA 1 cut(s) 225
Hpy8I GTNNAC 1 cut(s) 381
HpyAV CCTTC 1 cut(s) 181
HpyCH4III ACNGT 1 cut(s) 22
HpyCH4V TGCA 3 cut(s) 25, 61, 557
HpyF3I CTNAG 2 cut(s) 162, 273
Hsp92II CATG 1 cut(s) 141
Ksp22I TGATCA 1 cut(s) 391
Kzo9I GATC 2 cut(s) 391, 514
LpnPI CCDG 3 cut(s) 11, 149, 210
Lsp1109I GCAGC 1 cut(s) 541
MaeI CTAG 1 cut(s) 314
MaeIII GTNAC 3 cut(s) 249, 425, 508
MalI GATC 2 cut(s) 393, 516
MboI GATC 2 cut(s) 391, 514
MboII GAAGA 4 cut(s) 17, 121, 278, 376
MfeI CAATTG 2 cut(s) 62, 518
MhlI GDGCHC 1 cut(s) 163
MnlI CCTC 5 cut(s) 223, 268, 298, 320, 475
MseI TTAA 6 cut(s) 78, 101, 146, 330, 441, 560
MslI CAYNNNNRTG 5 cut(s) 56, 138, 275, 434, 452
MunI CAATTG 2 cut(s) 62, 518
Mva1269I GAATGC 1 cut(s) 213
NdeII GATC 2 cut(s) 391, 514
NlaIII CATG 1 cut(s) 141
NmuCI GTSAC 1 cut(s) 425
OliI CACNNNNGTG 1 cut(s) 275
PcsI WCGNNNNNNNCGW 1 cut(s) 428
PctI GAATGC 1 cut(s) 213
PfeI GAWTC 1 cut(s) 173
PkrI GCNGC 1 cut(s) 556
PpuMI RGGWCCY 1 cut(s) 307
PshBI ATTAAT 1 cut(s) 560
Psp124BI GAGCTC 1 cut(s) 163
Psp5II RGGWCCY 1 cut(s) 307
PspPI GGNCC 1 cut(s) 307
PspPPI RGGWCCY 1 cut(s) 307
RsaI GTAC 1 cut(s) 259
RsaNI GTAC 1 cut(s) 258
RseI CAYNNNNRTG 5 cut(s) 56, 138, 275, 434, 452
SacI GAGCTC 1 cut(s) 163
SaqAI TTAA 6 cut(s) 78, 101, 146, 330, 441, 560
SatI GCNGC 1 cut(s) 555
Sau3AI GATC 2 cut(s) 391, 514
Sau96I GGNCC 1 cut(s) 307
SduI GDGCHC 1 cut(s) 163
SetI ASST 8 cut(s) 30, 163, 168, 192, 259, 279, 309, 540
SinI GGWCC 1 cut(s) 307
SmiMI CAYNNNNRTG 5 cut(s) 56, 138, 275, 434, 452
SspMI CTAG 1 cut(s) 314
SstI GAGCTC 1 cut(s) 163
StyI CCWWGG 1 cut(s) 313
TaaI ACNGT 1 cut(s) 22
TfiI GAWTC 1 cut(s) 173
Tru1I TTAA 6 cut(s) 78, 101, 146, 330, 441, 560
Tru9I TTAA 6 cut(s) 78, 101, 146, 330, 441, 560
TscAI CASTG 2 cut(s) 27, 277
TseFI GTSAC 1 cut(s) 425
TseI GCWGC 1 cut(s) 554
Tsp45I GTSAC 1 cut(s) 425
TspDTI ATGAA 3 cut(s) 114, 389, 481
TspRI CASTG 2 cut(s) 27, 277
VpaK11BI GGWCC 1 cut(s) 307
VspI ATTAAT 1 cut(s) 560
XapI RAATTY 1 cut(s) 460
XmaJI CCTAGG 1 cut(s) 313
XspI CTAG 1 cut(s) 314
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.