MD00G1152200.v1.1

ribosome biogenesis protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Forward (+)
33379232 .. 33379913
682 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1152200.v1.1.491

Sequence Viewer

Length: 207 bp
ATGAAAATTACTGCTGAATTTAGCAGAGATCATAATATTCCCATCCCTGTTAACAGAGGTTCACTTTACATGCCAGTTGAAAGGAAGCCGAAGAAGTCTACAGGCCGGTGGTTCCTAAATCATTGCAAGATCTGCCATTTGCATCAAAATCGAATGATACAACCCATACAAGAAAAAATCAAACAGCTGTTGGATGAATCATCGTGA

Protein Analysis

69

Amino Acids

8.07

Weight (kDa)

9.83

Isoelectric Point (pI)

59.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 98
AcsI RAATTY 1 cut(s) 17
AgsI TTSAA 1 cut(s) 80
AluBI AGCT 1 cut(s) 187
AluI AGCT 1 cut(s) 187
AoxI GGCC 1 cut(s) 103
ApoI RAATTY 1 cut(s) 17
BccI CCATC 1 cut(s) 50
BcgI CGANNNNNNTGC 2 cut(s) 131, 165
BfmI CTRYAG 1 cut(s) 99
BglII AGATCT 1 cut(s) 129
BmiI GGNNCC 1 cut(s) 113
BmsI GCATC 1 cut(s) 151
Bse118I RCCGGY 1 cut(s) 105
Bse1I ACTGG 1 cut(s) 74
Bse3DI GCAATG 1 cut(s) 121
BseGI GGATG 2 cut(s) 42, 199
BseMI GCAATG 1 cut(s) 121
BseNI ACTGG 1 cut(s) 74
BshFI GGCC 1 cut(s) 105
BsiSI CCGG 1 cut(s) 106
BsnI GGCC 1 cut(s) 105
Bsp143I GATC 2 cut(s) 28, 129
BspANI GGCC 1 cut(s) 105
BspLI GGNNCC 1 cut(s) 113
BsrDI GCAATG 1 cut(s) 121
BsrFI RCCGGY 1 cut(s) 105
BsrI ACTGG 1 cut(s) 74
BssAI RCCGGY 1 cut(s) 105
BssMI GATC 2 cut(s) 28, 129
BstAPI GCANNNNNTGC 1 cut(s) 132
BstF5I GGATG 2 cut(s) 42, 199
BstKTI GATC 2 cut(s) 31, 132
BstMBI GATC 2 cut(s) 28, 129
BstMWI GCNNNNNNNGC 1 cut(s) 132
BstNSI RCATGY 1 cut(s) 73
BstSFI CTRYAG 1 cut(s) 99
BstX2I RGATCY 1 cut(s) 129
BstYI RGATCY 1 cut(s) 129
BsuRI GGCC 1 cut(s) 105
BtsCI GGATG 2 cut(s) 42, 199
Cfr10I RCCGGY 1 cut(s) 105
CviAII CATG 1 cut(s) 70
CviJI RGCY 3 cut(s) 88, 105, 187
CviKI_1 RGCY 3 cut(s) 88, 105, 187
DpnI GATC 2 cut(s) 30, 131
DpnII GATC 2 cut(s) 28, 129
FaeI CATG 1 cut(s) 73
FaiI YATR 3 cut(s) 33, 71, 167
FatI CATG 1 cut(s) 69
FblI GTMKAC 1 cut(s) 98
FokI GGATG 1 cut(s) 29
HaeIII GGCC 1 cut(s) 105
HapII CCGG 1 cut(s) 106
Hin1II CATG 1 cut(s) 73
HincII GTYRAC 1 cut(s) 52
HindII GTYRAC 1 cut(s) 52
HinfI GANTC 1 cut(s) 197
HpaI GTTAAC 1 cut(s) 52
HpaII CCGG 1 cut(s) 106
Hpy166II GTNNAC 3 cut(s) 52, 62, 99
Hpy188III TCNNGA 1 cut(s) 204
Hpy8I GTNNAC 3 cut(s) 52, 62, 99
HpyCH4V TGCA 2 cut(s) 126, 142
HpyF10VI GCNNNNNNNGC 1 cut(s) 132
Hsp92II CATG 1 cut(s) 73
KspAI GTTAAC 1 cut(s) 52
Kzo9I GATC 2 cut(s) 28, 129
LpnPI CCDG 4 cut(s) 60, 87, 87, 119
LweI GCATC 1 cut(s) 151
MalI GATC 2 cut(s) 30, 131
MboI GATC 2 cut(s) 28, 129
MboII GAAGA 1 cut(s) 103
MflI RGATCY 1 cut(s) 129
MluCI AATT 2 cut(s) 6, 17
MmeI TCCRAC 1 cut(s) 171
MnlI CCTC 1 cut(s) 50
MseI TTAA 1 cut(s) 51
MspA1I CMGCKG 1 cut(s) 187
MspI CCGG 1 cut(s) 106
MwoI GCNNNNNNNGC 1 cut(s) 132
NdeII GATC 2 cut(s) 28, 129
NlaIII CATG 1 cut(s) 73
NlaIV GGNNCC 1 cut(s) 113
NspI RCATGY 1 cut(s) 73
PfeI GAWTC 1 cut(s) 197
PspN4I GGNNCC 1 cut(s) 113
PsuI RGATCY 1 cut(s) 129
PvuII CAGCTG 1 cut(s) 187
SaqAI TTAA 1 cut(s) 51
Sau3AI GATC 2 cut(s) 28, 129
SetI ASST 2 cut(s) 61, 189
SfaNI GCATC 1 cut(s) 151
SfcI CTRYAG 1 cut(s) 99
SgeI CNNG 7 cut(s) 59, 82, 86, 114, 118, 139, 182
Sse9I AATT 2 cut(s) 6, 17
SspI AATATT 1 cut(s) 37
TaqI TCGA 1 cut(s) 151
TasI AATT 2 cut(s) 6, 17
TfiI GAWTC 1 cut(s) 197
Tru1I TTAA 1 cut(s) 51
Tru9I TTAA 1 cut(s) 51
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 17
XceI RCATGY 1 cut(s) 73
XmiI GTMKAC 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.