Rorug04G0068300

ribosome biogenesis protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
10696133 .. 10696830
698 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0068300.1

Sequence Viewer

Length: 195 bp
ATGTCTTTCTTTCTGTACTCCGCTGAAAGAAAGCGTGTAATAGAGAGAAAGCTGTTTCTGGTCCTGGGACAACGGATATTCGTTTTGCTCAGGGGCTTGGTTGTCTACCTTGATTGTCTTTCTCACAGCCAGAAAGAGAGGAATACCTTGGGTGGAAAGGTTGCCAACATAAGTGCACGAAGAATTGCTGGATAA

Protein Analysis

64

Amino Acids

7.34

Weight (kDa)

10.94

Isoelectric Point (pI)

49.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 105
AciI CCGC 1 cut(s) 21
AfaI GTAC 1 cut(s) 17
AjnI CCWGG 1 cut(s) 63
AluBI AGCT 1 cut(s) 52
AluI AGCT 1 cut(s) 52
Alw21I GWGCWC 1 cut(s) 178
Alw44I GTGCAC 1 cut(s) 174
ApaLI GTGCAC 1 cut(s) 174
AspS9I GGNCC 1 cut(s) 61
AvaII GGWCC 1 cut(s) 61
BaeGI GKGCMC 1 cut(s) 178
Bbv12I GWGCWC 1 cut(s) 178
BciT130I CCWGG 1 cut(s) 65
Bme1390I CCNGG 1 cut(s) 65
Bme18I GGWCC 1 cut(s) 61
BmgT120I GGNCC 1 cut(s) 61
BmrFI CCNGG 1 cut(s) 65
Bpu10I CCTNAGC 1 cut(s) 89
BsaJI CCNNGG 2 cut(s) 64, 147
BseBI CCWGG 1 cut(s) 65
BseDI CCNNGG 2 cut(s) 64, 147
BseMII CTCAG 1 cut(s) 103
BseSI GKGCMC 1 cut(s) 178
BsiHKAI GWGCWC 1 cut(s) 178
BslFI GGGAC 1 cut(s) 81
BsmFI GGGAC 1 cut(s) 81
Bsp1286I GDGCHC 1 cut(s) 178
BspACI CCGC 1 cut(s) 21
BspCNI CTCAG 1 cut(s) 102
BssECI CCNNGG 2 cut(s) 64, 147
BssT1I CCWWGG 1 cut(s) 147
Bst2UI CCWGG 1 cut(s) 65
BstDEI CTNAG 1 cut(s) 89
BstNI CCWGG 1 cut(s) 65
BstSCI CCNGG 1 cut(s) 63
BstSLI GKGCMC 1 cut(s) 178
Cfr13I GGNCC 1 cut(s) 61
Csp6I GTAC 1 cut(s) 16
CviJI RGCY 3 cut(s) 52, 96, 129
CviKI_1 RGCY 3 cut(s) 52, 96, 129
CviQI GTAC 1 cut(s) 16
DdeI CTNAG 1 cut(s) 89
Eco130I CCWWGG 1 cut(s) 147
Eco47I GGWCC 1 cut(s) 61
EcoRII CCWGG 1 cut(s) 63
EcoT14I CCWWGG 1 cut(s) 147
ErhI CCWWGG 1 cut(s) 147
FaiI YATR 1 cut(s) 170
FaqI GGGAC 1 cut(s) 81
FblI GTMKAC 1 cut(s) 105
Hpy166II GTNNAC 2 cut(s) 106, 176
Hpy8I GTNNAC 2 cut(s) 106, 176
HpyCH4V TGCA 1 cut(s) 176
HpyF3I CTNAG 1 cut(s) 89
LpnPI CCDG 6 cut(s) 44, 50, 76, 77, 143, 174
MboII GAAGA 1 cut(s) 192
MhlI GDGCHC 1 cut(s) 178
MluCI AATT 1 cut(s) 183
MnlI CCTC 1 cut(s) 132
MspA1I CMGCKG 1 cut(s) 23
MspR9I CCNGG 1 cut(s) 65
MvaI CCWGG 1 cut(s) 65
Psp6I CCWGG 1 cut(s) 63
PspGI CCWGG 1 cut(s) 63
PspPI GGNCC 1 cut(s) 61
RsaI GTAC 1 cut(s) 17
RsaNI GTAC 1 cut(s) 16
Sau96I GGNCC 1 cut(s) 61
ScrFI CCNGG 1 cut(s) 65
SduI GDGCHC 1 cut(s) 178
SetI ASST 4 cut(s) 54, 111, 149, 162
SinI GGWCC 1 cut(s) 61
Sse9I AATT 1 cut(s) 183
SsiI CCGC 1 cut(s) 21
StyD4I CCNGG 1 cut(s) 63
StyI CCWWGG 1 cut(s) 147
TasI AATT 1 cut(s) 183
TatI WGTACW 1 cut(s) 15
TspGWI ACGGA 1 cut(s) 88
VneI GTGCAC 1 cut(s) 174
VpaK11BI GGWCC 1 cut(s) 61
XmiI GTMKAC 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.