Rh2BG258500

ribosome biogenesis protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
27176476 .. 27177008
533 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG258500.1

Sequence Viewer

Length: 300 bp
ATGGATAGTGGGACTAAGGAGCAGTCGCATAAGGGCCATAGGGCCAGGCAGTCGGGTCCTAAGGCTAATAAGAAGCCTGAAACCTCAAGAATCGACCGAGCAGAACAGGCCTATGGCGAAGAACCAGCTCCATACGTTGTTGTGGTGCATGGACCTCCAAAGGTTGGCAAGTCCTTGTTAATAGAGTCACTCGTAAAGCATTATACCAAGCTCGATTTGCCTGAGAAGGTTCGAGGCCCGATTACCATTGTGTCAGGTAGTTACAGATTGTGGAGTGCCCGAATGACATCAACGGTATGA

Protein Analysis

99

Amino Acids

10.95

Weight (kDa)

9.87

Isoelectric Point (pI)

47.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 164
AfiI CCNNNNNNNGG 1 cut(s) 164
AjnI CCWGG 1 cut(s) 44
AluBI AGCT 2 cut(s) 128, 211
AluI AGCT 2 cut(s) 128, 211
AoxI GGCC 4 cut(s) 34, 42, 108, 235
AspS9I GGNCC 5 cut(s) 34, 42, 56, 152, 236
AvaII GGWCC 2 cut(s) 56, 152
AxyI CCTNAGG 1 cut(s) 60
BaeGI GKGCMC 1 cut(s) 280
BciT130I CCWGG 1 cut(s) 46
Bme1390I CCNGG 1 cut(s) 46
Bme18I GGWCC 2 cut(s) 56, 152
BmgT120I GGNCC 5 cut(s) 34, 42, 56, 152, 236
BmiI GGNNCC 1 cut(s) 57
BmrFI CCNGG 1 cut(s) 46
BpuEI CTTGAG 1 cut(s) 70
Bsc4I CCNNNNNNNGG 1 cut(s) 164
Bse21I CCTNAGG 1 cut(s) 60
BseBI CCWGG 1 cut(s) 46
BseLI CCNNNNNNNGG 1 cut(s) 164
BseMII CTCAG 1 cut(s) 213
BseSI GKGCMC 1 cut(s) 280
Bsh1285I CGRYCG 1 cut(s) 97
BshFI GGCC 4 cut(s) 36, 44, 110, 237
BsiEI CGRYCG 1 cut(s) 97
BslFI GGGAC 1 cut(s) 25
BslI CCNNNNNNNGG 1 cut(s) 164
BsmFI GGGAC 1 cut(s) 25
BsnI GGCC 4 cut(s) 36, 44, 110, 237
Bsp1286I GDGCHC 1 cut(s) 280
BspANI GGCC 4 cut(s) 36, 44, 110, 237
BspCNI CTCAG 1 cut(s) 214
BspLI GGNNCC 1 cut(s) 57
Bst2UI CCWGG 1 cut(s) 46
Bst4CI ACNGT 1 cut(s) 295
BstDEI CTNAG 3 cut(s) 15, 60, 222
BstMCI CGRYCG 1 cut(s) 97
BstMWI GCNNNNNNNGC 2 cut(s) 107, 217
BstNI CCWGG 1 cut(s) 46
BstSCI CCNGG 1 cut(s) 44
BstSLI GKGCMC 1 cut(s) 280
Bsu36I CCTNAGG 1 cut(s) 60
BsuRI GGCC 4 cut(s) 36, 44, 110, 237
Cfr13I GGNCC 5 cut(s) 34, 42, 56, 152, 236
CviAII CATG 1 cut(s) 149
CviJI RGCY 8 cut(s) 36, 44, 65, 76, 110, 128, 211, 237
CviKI_1 RGCY 8 cut(s) 36, 44, 65, 76, 110, 128, 211, 237
DdeI CTNAG 3 cut(s) 15, 60, 222
Eco147I AGGCCT 1 cut(s) 110
Eco47I GGWCC 2 cut(s) 56, 152
Eco81I CCTNAGG 1 cut(s) 60
EcoO109I RGGNCCY 1 cut(s) 56
EcoRII CCWGG 1 cut(s) 44
FaeI CATG 1 cut(s) 152
FaiI YATR 7 cut(s) 30, 39, 114, 133, 150, 204, 298
FaqI GGGAC 1 cut(s) 25
FatI CATG 1 cut(s) 148
HaeIII GGCC 4 cut(s) 36, 44, 110, 237
Hin1II CATG 1 cut(s) 152
HinfI GANTC 2 cut(s) 90, 185
Hpy188III TCNNGA 1 cut(s) 87
HpyAV CCTTC 1 cut(s) 220
HpyCH4III ACNGT 1 cut(s) 295
HpyCH4IV ACGT 1 cut(s) 135
HpyCH4V TGCA 1 cut(s) 148
HpyF10VI GCNNNNNNNGC 2 cut(s) 107, 217
HpyF3I CTNAG 3 cut(s) 15, 60, 222
HpySE526I ACGT 1 cut(s) 135
Hsp92II CATG 1 cut(s) 152
LmnI GCTCC 2 cut(s) 19, 133
LpnPI CCDG 7 cut(s) 31, 58, 90, 92, 138, 234, 240
MaeII ACGT 1 cut(s) 135
MaeIII GTNAC 2 cut(s) 186, 260
MboII GAAGA 1 cut(s) 131
MhlI GDGCHC 1 cut(s) 280
MlyI GAGTC 1 cut(s) 194
MnlI CCTC 3 cut(s) 94, 165, 227
MseI TTAA 1 cut(s) 179
MspR9I CCNGG 1 cut(s) 46
MvaI CCWGG 1 cut(s) 46
MwoI GCNNNNNNNGC 2 cut(s) 107, 217
NlaIII CATG 1 cut(s) 152
NlaIV GGNNCC 1 cut(s) 57
NmuCI GTSAC 1 cut(s) 186
PceI AGGCCT 1 cut(s) 110
PfeI GAWTC 1 cut(s) 90
PflMI CCANNNNNTGG 1 cut(s) 164
PleI GAGTC 1 cut(s) 193
PpsI GAGTC 1 cut(s) 193
PpuMI RGGWCCY 1 cut(s) 56
Psp5II RGGWCCY 1 cut(s) 56
Psp6I CCWGG 1 cut(s) 44
PspGI CCWGG 1 cut(s) 44
PspN4I GGNNCC 1 cut(s) 57
PspPI GGNCC 5 cut(s) 34, 42, 56, 152, 236
PspPPI RGGWCCY 1 cut(s) 56
SaqAI TTAA 1 cut(s) 179
Sau96I GGNCC 5 cut(s) 34, 42, 56, 152, 236
SchI GAGTC 1 cut(s) 194
ScrFI CCNGG 1 cut(s) 46
SduI GDGCHC 1 cut(s) 280
SetI ASST 8 cut(s) 86, 130, 138, 157, 165, 213, 231, 259
SinI GGWCC 2 cut(s) 56, 152
SmlI CTYRAG 1 cut(s) 85
SmoI CTYRAG 1 cut(s) 85
SseBI AGGCCT 1 cut(s) 110
StuI AGGCCT 1 cut(s) 110
StyD4I CCNGG 1 cut(s) 44
TaaI ACNGT 1 cut(s) 295
TaiI ACGT 1 cut(s) 138
TaqI TCGA 3 cut(s) 93, 213, 232
TaqII GACCGA 1 cut(s) 111
TfiI GAWTC 1 cut(s) 90
Tru1I TTAA 1 cut(s) 179
Tru9I TTAA 1 cut(s) 179
TseFI GTSAC 1 cut(s) 186
Tsp45I GTSAC 1 cut(s) 186
Van91I CCANNNNNTGG 1 cut(s) 164
VpaK11BI GGWCC 2 cut(s) 56, 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.