MD05G1327600.v1.1

Belongs to the glucose-6-phosphate 1-epimerase family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
Physical Location & Seq
Forward (+)
45333317 .. 45335547
2231 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1327600.v1.1.491

Sequence Viewer

Length: 192 bp
ATGGGTGATGAGGTCCGAGCTGGTGATGAAGCCGATCGTTTCTCTCGTACCGAAATTCGTGTAGAAGGATTGGAAACATTGGATTATCTTGACAACACGCAGAACAGGAAACGTTGCACTGAACAAGGCGATGCTTTAACATTTGAGTCAGAGTTGTATGGAATCCCTGGGATAAGAAGGCGAAGGCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.32

Weight (kDa)

4.88

Isoelectric Point (pI)

61.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 112
AcsI RAATTY 1 cut(s) 54
AfaI GTAC 1 cut(s) 49
AjnI CCWGG 1 cut(s) 166
AluBI AGCT 1 cut(s) 20
AluI AGCT 1 cut(s) 20
ApoI RAATTY 1 cut(s) 54
AspS9I GGNCC 1 cut(s) 13
AsuHPI GGTGA 2 cut(s) 17, 35
AvaII GGWCC 1 cut(s) 13
BciT130I CCWGG 1 cut(s) 168
Bme1390I CCNGG 1 cut(s) 168
Bme18I GGWCC 1 cut(s) 13
BmgT120I GGNCC 1 cut(s) 13
BmrFI CCNGG 1 cut(s) 168
BmsI GCATC 1 cut(s) 121
BsaJI CCNNGG 2 cut(s) 166, 167
BseBI CCWGG 1 cut(s) 168
BseDI CCNNGG 2 cut(s) 166, 167
Bsh1285I CGRYCG 1 cut(s) 37
BsiEI CGRYCG 1 cut(s) 37
Bsp143I GATC 1 cut(s) 34
BssECI CCNNGG 2 cut(s) 166, 167
BssMI GATC 1 cut(s) 34
Bst2UI CCWGG 1 cut(s) 168
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
BstMCI CGRYCG 1 cut(s) 37
BstNI CCWGG 1 cut(s) 168
BstSCI CCNGG 1 cut(s) 166
BtgZI GCGATG 1 cut(s) 144
BtsIMutI CAGTG 1 cut(s) 117
Cfr13I GGNCC 1 cut(s) 13
Csp6I GTAC 1 cut(s) 48
CviJI RGCY 3 cut(s) 20, 32, 187
CviKI_1 RGCY 3 cut(s) 20, 32, 187
CviQI GTAC 1 cut(s) 48
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
Eco47I GGWCC 1 cut(s) 13
EcoRII CCWGG 1 cut(s) 166
FaiI YATR 1 cut(s) 159
HinfI GANTC 2 cut(s) 146, 162
HphI GGTGA 2 cut(s) 17, 35
Hpy188I TCNGA 2 cut(s) 17, 151
Hpy188III TCNNGA 1 cut(s) 89
HpyAV CCTTC 3 cut(s) 59, 171, 177
HpyCH4IV ACGT 1 cut(s) 112
HpyCH4V TGCA 1 cut(s) 117
HpySE526I ACGT 1 cut(s) 112
Kzo9I GATC 1 cut(s) 34
LpnPI CCDG 4 cut(s) 6, 91, 153, 180
LweI GCATC 1 cut(s) 121
MaeII ACGT 1 cut(s) 112
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MluCI AATT 1 cut(s) 54
MlyI GAGTC 1 cut(s) 155
MnlI CCTC 1 cut(s) 4
MseI TTAA 1 cut(s) 137
MspR9I CCNGG 1 cut(s) 168
MvaI CCWGG 1 cut(s) 168
NdeII GATC 1 cut(s) 34
PasI CCCWGGG 1 cut(s) 167
PcsI WCGNNNNNNNCGW 1 cut(s) 43
PfeI GAWTC 1 cut(s) 162
Ple19I CGATCG 1 cut(s) 37
PleI GAGTC 1 cut(s) 154
PpsI GAGTC 1 cut(s) 154
Psp1406I AACGTT 1 cut(s) 112
Psp6I CCWGG 1 cut(s) 166
PspGI CCWGG 1 cut(s) 166
PspPI GGNCC 1 cut(s) 13
PvuI CGATCG 1 cut(s) 37
RsaI GTAC 1 cut(s) 49
RsaNI GTAC 1 cut(s) 48
SaqAI TTAA 1 cut(s) 137
Sau3AI GATC 1 cut(s) 34
Sau96I GGNCC 1 cut(s) 13
SchI GAGTC 1 cut(s) 155
ScrFI CCNGG 1 cut(s) 168
SetI ASST 3 cut(s) 15, 22, 115
SfaNI GCATC 1 cut(s) 121
SinI GGWCC 1 cut(s) 13
Sse9I AATT 1 cut(s) 54
StyD4I CCNGG 1 cut(s) 166
TaiI ACGT 1 cut(s) 115
TasI AATT 1 cut(s) 54
TfiI GAWTC 1 cut(s) 162
Tru1I TTAA 1 cut(s) 137
Tru9I TTAA 1 cut(s) 137
TscAI CASTG 1 cut(s) 124
TspDTI ATGAA 1 cut(s) 42
TspRI CASTG 1 cut(s) 124
VpaK11BI GGWCC 1 cut(s) 13
XapI RAATTY 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.