Rroxscaffold_1G00059320

Belongs to the glucose-6-phosphate 1-epimerase family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
81316842 .. 81317211
370 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00059320.1

Sequence Viewer

Length: 171 bp
ATGCAGAACAGGAAATGTTGTACTGAGCAAGGGGATGCTATAACATTTGAATCGGGGGTGGACAAGATATATCTTAGCACTCCTACAAAGATTGCAATTATGGATCATGAGAAGAACAGAACATTTGTAATACGCAAAGATGGTCTTCCAGATGCCAGTAAGGCTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.3

Weight (kDa)

6.55

Isoelectric Point (pI)

23.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 111
AfaI GTAC 1 cut(s) 22
AgsI TTSAA 1 cut(s) 50
AlwI GGATC 1 cut(s) 111
BbsI GAAGAC 1 cut(s) 137
BccI CCATC 1 cut(s) 134
BglI GCCNNNNNGGC 1 cut(s) 161
BmsI GCATC 2 cut(s) 25, 142
BpiI GAAGAC 1 cut(s) 137
Bse1I ACTGG 1 cut(s) 156
BseGI GGATG 1 cut(s) 40
BseMII CTCAG 1 cut(s) 15
BseNI ACTGG 1 cut(s) 156
Bsp143I GATC 1 cut(s) 103
BspCNI CTCAG 1 cut(s) 16
BspHI TCATGA 1 cut(s) 106
BspPI GGATC 1 cut(s) 111
BsrI ACTGG 1 cut(s) 156
BssMI GATC 1 cut(s) 103
BstDEI CTNAG 2 cut(s) 24, 74
BstF5I GGATG 1 cut(s) 40
BstKTI GATC 1 cut(s) 106
BstMBI GATC 1 cut(s) 103
BstMWI GCNNNNNNNGC 1 cut(s) 161
BstV2I GAAGAC 1 cut(s) 137
BtsCI GGATG 1 cut(s) 40
CciI TCATGA 1 cut(s) 106
Csp6I GTAC 1 cut(s) 21
CviAII CATG 1 cut(s) 107
CviJI RGCY 1 cut(s) 164
CviKI_1 RGCY 1 cut(s) 164
CviQI GTAC 1 cut(s) 21
DdeI CTNAG 2 cut(s) 24, 74
DpnI GATC 1 cut(s) 105
DpnII GATC 1 cut(s) 103
FaeI CATG 1 cut(s) 110
FaiI YATR 4 cut(s) 41, 70, 101, 108
FalI AAGNNNNNCTT 2 cut(s) 129, 161
FatI CATG 1 cut(s) 106
FokI GGATG 1 cut(s) 47
Hin1II CATG 1 cut(s) 110
HinfI GANTC 1 cut(s) 50
Hpy166II GTNNAC 1 cut(s) 61
Hpy188III TCNNGA 2 cut(s) 107, 149
Hpy8I GTNNAC 1 cut(s) 61
HpyCH4V TGCA 2 cut(s) 4, 95
HpyF10VI GCNNNNNNNGC 1 cut(s) 161
HpyF3I CTNAG 2 cut(s) 24, 74
Hsp92II CATG 1 cut(s) 110
Kzo9I GATC 1 cut(s) 103
LpnPI CCDG 1 cut(s) 162
LweI GCATC 2 cut(s) 25, 142
MalI GATC 1 cut(s) 105
MboI GATC 1 cut(s) 103
MboII GAAGA 2 cut(s) 124, 137
MluCI AATT 1 cut(s) 96
MwoI GCNNNNNNNGC 1 cut(s) 161
NdeII GATC 1 cut(s) 103
NlaIII CATG 1 cut(s) 110
PagI TCATGA 1 cut(s) 106
PfeI GAWTC 1 cut(s) 50
RsaI GTAC 1 cut(s) 22
RsaNI GTAC 1 cut(s) 21
Sau3AI GATC 1 cut(s) 103
SfaNI GCATC 2 cut(s) 25, 142
SgeI CNNG 6 cut(s) 22, 41, 66, 76, 119, 161
Sse9I AATT 1 cut(s) 96
TasI AATT 1 cut(s) 96
TatI WGTACW 1 cut(s) 20
TfiI GAWTC 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.