Rh3BG233300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
OG0000789
Physical Location & Seq
Forward (+)
21743933 .. 21760916
16984 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG233300.1

Sequence Viewer

Length: 297 bp
ATGAGTGTGTTACAACCTCCGAAAGATATTGTGATACCCATCGTGTTTGACTCGGACTCTGACTCAAATCTTCTCCTCTGCTCCTATTGCCTTCTTCACCGCTCCTATTGTTGCTCGGCTAATGTGACTATAGATGTAACTTGGCTTTTCATATTTCTGGTTCAAGGGTTAGCTGGAGACAACGAAGAAGGATCAACAAATAAACGATTGGCTTTTCGTATTTCTGGGTCTGTGAGATGCATCATTGACCCAATGTCTGTGTTTTCAGAGTCGTCAAAAGTGAACCATATATATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

98

Amino Acids

10.91

Weight (kDa)

5.07

Isoelectric Point (pI)

51.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 102
AciI CCGC 1 cut(s) 100
AclWI GGATC 1 cut(s) 199
AgsI TTSAA 1 cut(s) 164
AhdI GACNNNNNGTC 1 cut(s) 253
AluBI AGCT 1 cut(s) 173
AluI AGCT 1 cut(s) 173
Alw26I GTCTC 1 cut(s) 171
AlwI GGATC 1 cut(s) 199
AsuHPI GGTGA 1 cut(s) 89
BccI CCATC 1 cut(s) 47
BcoDI GTCTC 1 cut(s) 171
BfmI CTRYAG 1 cut(s) 129
BmeRI GACNNNNNGTC 1 cut(s) 253
BmsI GCATC 2 cut(s) 227, 249
BpmI CTGGAG 1 cut(s) 195
BsaBI GATNNNNATC 1 cut(s) 38
Bse8I GATNNNNATC 1 cut(s) 38
BseJI GATNNNNATC 1 cut(s) 38
BseRI GAGGAG 1 cut(s) 65
BsmAI GTCTC 1 cut(s) 171
Bsp143I GATC 1 cut(s) 191
BspACI CCGC 1 cut(s) 100
BspPI GGATC 1 cut(s) 199
BsrBI CCGCTC 1 cut(s) 102
BssMI GATC 1 cut(s) 191
BstKTI GATC 1 cut(s) 194
BstMAI GTCTC 1 cut(s) 171
BstMBI GATC 1 cut(s) 191
BstMWI GCNNNNNNNGC 1 cut(s) 87
BstSFI CTRYAG 1 cut(s) 129
CviJI RGCY 4 cut(s) 119, 145, 173, 212
CviKI_1 RGCY 4 cut(s) 119, 145, 173, 212
DpnI GATC 1 cut(s) 193
DpnII GATC 1 cut(s) 191
DriI GACNNNNNGTC 1 cut(s) 253
Eam1105I GACNNNNNGTC 1 cut(s) 253
EcoT22I ATGCAT 1 cut(s) 242
FaiI YATR 5 cut(s) 131, 152, 288, 290, 292
GsuI CTGGAG 1 cut(s) 195
HinfI GANTC 4 cut(s) 50, 56, 62, 269
HphI GGTGA 1 cut(s) 89
Hpy166II GTNNAC 1 cut(s) 283
Hpy188I TCNGA 4 cut(s) 21, 55, 61, 268
Hpy8I GTNNAC 1 cut(s) 283
HpyAV CCTTC 2 cut(s) 101, 182
HpyCH4V TGCA 1 cut(s) 240
HpyF10VI GCNNNNNNNGC 1 cut(s) 87
Kzo9I GATC 1 cut(s) 191
LmnI GCTCC 2 cut(s) 86, 107
LpnPI CCDG 3 cut(s) 143, 159, 210
LweI GCATC 2 cut(s) 227, 249
MaeIII GTNAC 3 cut(s) 9, 124, 136
MalI GATC 1 cut(s) 193
MbiI CCGCTC 1 cut(s) 102
MboI GATC 1 cut(s) 191
MboII GAAGA 3 cut(s) 62, 86, 197
MlyI GAGTC 4 cut(s) 44, 50, 56, 278
MnlI CCTC 2 cut(s) 27, 86
Mph1103I ATGCAT 1 cut(s) 242
MwoI GCNNNNNNNGC 1 cut(s) 87
NdeII GATC 1 cut(s) 191
NmeAIII GCCGAG 1 cut(s) 95
NmuCI GTSAC 1 cut(s) 124
NsiI ATGCAT 1 cut(s) 242
PleI GAGTC 4 cut(s) 44, 50, 56, 277
PpsI GAGTC 4 cut(s) 44, 50, 56, 277
Sau3AI GATC 1 cut(s) 191
SchI GAGTC 4 cut(s) 44, 50, 56, 278
SetI ASST 2 cut(s) 19, 175
SfaNI GCATC 2 cut(s) 227, 249
SfcI CTRYAG 1 cut(s) 129
SgeI CNNG 8 cut(s) 55, 64, 127, 153, 170, 176, 186, 237
SsiI CCGC 1 cut(s) 100
TseFI GTSAC 1 cut(s) 124
Tsp45I GTSAC 1 cut(s) 124
TspDTI ATGAA 1 cut(s) 139
Zsp2I ATGCAT 1 cut(s) 242
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.