Rroxscaffold_1G00033540

5-formyltetrahydrofolate cyclo-ligase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
48568364 .. 48568588
225 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00033540.1

Sequence Viewer

Length: 225 bp
ATGTTTCTTGTGTTGTGCGAAGATGGTGATCTGCAAGTGAGGAAGAAGCTTTATGTGCCACAAGTGGAGGACAAGAATAGTCACATGAGAATGCTCAACATCTCTTGTGTTCATGATCCGGTTGCGAATTCGATGGATATTTTAAAAGTGGCTATGGTGGATGCCAATGGAAATGAATGCGAAGACGGTAGTGTTTCACTTACTTCTTACAAGCCTTATCGTTGA

Protein Analysis

74

Amino Acids

8.36

Weight (kDa)

5.13

Isoelectric Point (pI)

31.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 110
AcsI RAATTY 1 cut(s) 127
AluBI AGCT 1 cut(s) 49
AluI AGCT 1 cut(s) 49
AlwI GGATC 1 cut(s) 110
ApoI RAATTY 1 cut(s) 127
AsuHPI GGTGA 1 cut(s) 38
BbsI GAAGAC 1 cut(s) 189
BccI CCATC 2 cut(s) 17, 127
BmsI GCATC 1 cut(s) 151
BpiI GAAGAC 1 cut(s) 189
BsaBI GATNNNNATC 1 cut(s) 27
BsaWI WCCGGW 1 cut(s) 118
Bse8I GATNNNNATC 1 cut(s) 27
BseGI GGATG 1 cut(s) 166
BseJI GATNNNNATC 1 cut(s) 27
BsiSI CCGG 1 cut(s) 119
BsmI GAATGC 2 cut(s) 96, 182
Bsp143I GATC 2 cut(s) 28, 115
BspHI TCATGA 1 cut(s) 112
BspPI GGATC 1 cut(s) 110
BssMI GATC 2 cut(s) 28, 115
Bst4CI ACNGT 1 cut(s) 188
BstF5I GGATG 1 cut(s) 166
BstKTI GATC 2 cut(s) 31, 118
BstMBI GATC 2 cut(s) 28, 115
BstMWI GCNNNNNNNGC 1 cut(s) 55
BstV2I GAAGAC 1 cut(s) 189
BtsCI GGATG 1 cut(s) 166
CciI TCATGA 1 cut(s) 112
CviAII CATG 2 cut(s) 85, 113
CviJI RGCY 3 cut(s) 49, 152, 214
CviKI_1 RGCY 3 cut(s) 49, 152, 214
DpnI GATC 2 cut(s) 30, 117
DpnII GATC 2 cut(s) 28, 115
DraI TTTAAA 1 cut(s) 144
EcoRI GAATTC 1 cut(s) 127
FaeI CATG 2 cut(s) 88, 116
FaiI YATR 4 cut(s) 54, 86, 114, 155
FatI CATG 2 cut(s) 84, 112
FokI GGATG 1 cut(s) 173
HapII CCGG 1 cut(s) 119
Hin1II CATG 2 cut(s) 88, 116
HindIII AAGCTT 1 cut(s) 47
HpaII CCGG 1 cut(s) 119
HphI GGTGA 1 cut(s) 38
Hpy188III TCNNGA 1 cut(s) 113
HpyCH4III ACNGT 1 cut(s) 188
HpyCH4V TGCA 1 cut(s) 34
HpyF10VI GCNNNNNNNGC 1 cut(s) 55
Hsp92II CATG 2 cut(s) 88, 116
Kzo9I GATC 2 cut(s) 28, 115
LpnPI CCDG 1 cut(s) 132
LweI GCATC 1 cut(s) 151
MaeIII GTNAC 1 cut(s) 80
MalI GATC 2 cut(s) 30, 117
MboI GATC 2 cut(s) 28, 115
MboII GAAGA 3 cut(s) 32, 55, 194
MluCI AATT 1 cut(s) 127
MnlI CCTC 2 cut(s) 33, 61
MseI TTAA 1 cut(s) 143
MslI CAYNNNNRTG 1 cut(s) 89
MspI CCGG 1 cut(s) 119
Mva1269I GAATGC 2 cut(s) 96, 182
MwoI GCNNNNNNNGC 1 cut(s) 55
NdeII GATC 2 cut(s) 28, 115
NlaIII CATG 2 cut(s) 88, 116
NmuCI GTSAC 1 cut(s) 80
PagI TCATGA 1 cut(s) 112
PctI GAATGC 2 cut(s) 96, 182
RseI CAYNNNNRTG 1 cut(s) 89
SaqAI TTAA 1 cut(s) 143
Sau3AI GATC 2 cut(s) 28, 115
SetI ASST 1 cut(s) 51
SfaNI GCATC 1 cut(s) 151
SgeI CNNG 8 cut(s) 20, 47, 74, 85, 97, 117, 125, 131
SmiMI CAYNNNNRTG 1 cut(s) 89
Sse9I AATT 1 cut(s) 127
TaaI ACNGT 1 cut(s) 188
TaqI TCGA 1 cut(s) 131
TasI AATT 1 cut(s) 127
Tru1I TTAA 1 cut(s) 143
Tru9I TTAA 1 cut(s) 143
TseFI GTSAC 1 cut(s) 80
Tsp45I GTSAC 1 cut(s) 80
TspDTI ATGAA 2 cut(s) 101, 189
XapI RAATTY 1 cut(s) 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.