Rmu_sc0004591.1_g000012

Belongs to the glucose-6-phosphate 1-epimerase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004591.1
OG0000789
Physical Location & Seq
Forward (+)
40071 .. 46033
5963 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004591.1_g000012.1.cds

Sequence Viewer

Length: 933 bp
atgttctcaaccgtatcctttgtgcttagtagaaatgctacgtggaacagctggcattgctgtgtcagcaaatcagttgtggtgtatttgtatgggggtcatgtaacatcatggaagaatgaccagggggaggaattgctatttgtcagcaataaggctatatttaagcctccaaaagcaattcgtggggggatcccaatttgctttccacaattttcaaatcttggttctcttgatgcacatggatttgctagaaacagattttggagcattgaccctgatccatctccttttccaacaaatacttccaataaggtttttgttgatttgattcttaagcctactgaagaagatattaagacttggccttatagttatgagttccggctgcgagtagctttgggacctggaggagatctgatgttgacatctcgcatccggaatactaactctgatgggaagccattcacattcacgtttgcttatcatacttatttctctgtttcagatataagtgaagttcgtgtagaaggcttggagaccctcgattatctggacaacatgcagaacaggaaacgttgtactgagcaaggggatgctataacatttgaatcggaggtcgacaagatatatcttagcactcctacaaagattgcaattctggatcatgagaagaagagaacatttgtaatacgtaaagatgggcttccagatgctgtggtgtggaatccctgggataagaaggcaaaggctatggctgattttggagatgatgagtacaaacatatgctctgtgtggaggctgctgctattgagagacctatcacattgaaacccggagaggagtggagaggaaggcaggagctttcagctgttccttccagttactgtagtgggcaacttgatcctcgaaaggttctccagggaagttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00010 ko01100 ko01110 ko01120 ko01130 map00010 map01100 map01110 map01120 map01130
Pfam Domains
Protein Families
Aldose_epim

Protein Analysis

310

Amino Acids

35.17

Weight (kDa)

6.61

Isoelectric Point (pI)

30.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 621
AccIII TCCGGA 1 cut(s) 438
AclI AACGTT 1 cut(s) 577
AclWI GGATC 5 cut(s) 187, 200, 275, 672, 899
AcuI CTGAAG 1 cut(s) 366
AfaI GTAC 2 cut(s) 583, 779
AfiI CCNNNNNNNGG 1 cut(s) 130
AflII CTTAAG 1 cut(s) 335
AgsI TTSAA 3 cut(s) 219, 611, 832
AjnI CCWGG 4 cut(s) 123, 406, 731, 921
AjuI GAANNNNNNNTTGG 4 cut(s) 247, 279, 289, 321
AluBI AGCT 4 cut(s) 51, 398, 865, 872
AluI AGCT 4 cut(s) 51, 398, 865, 872
Alw26I GTCTC 2 cut(s) 533, 811
AlwI GGATC 5 cut(s) 187, 200, 275, 672, 899
AlwNI CAGNNNCTG 2 cut(s) 716, 888
Aor13HI TCCGGA 1 cut(s) 438
AoxI GGCC 1 cut(s) 365
ApeKI GCWGC 3 cut(s) 388, 803, 806
Asp700I GAANNNNTTC 1 cut(s) 464
AspS9I GGNCC 1 cut(s) 404
AsuC2I CCSGG 1 cut(s) 837
AvaII GGWCC 1 cut(s) 404
BamHI GGATCC 1 cut(s) 192
BbvI GCAGC 3 cut(s) 375, 790, 793
BccI CCATC 3 cut(s) 292, 449, 695
BciT130I CCWGG 4 cut(s) 125, 408, 733, 923
BciVI GTATCC 1 cut(s) 25
BcnI CCSGG 1 cut(s) 837
BcoDI GTCTC 2 cut(s) 533, 811
BfaI CTAG 1 cut(s) 252
BfmI CTRYAG 1 cut(s) 889
BfrI CTTAAG 1 cut(s) 335
BfuI GTATCC 1 cut(s) 25
BglII AGATCT 1 cut(s) 415
BisI GCNGC 3 cut(s) 389, 804, 807
BlsI GCNGC 3 cut(s) 390, 805, 808
Bme1390I CCNGG 5 cut(s) 125, 408, 733, 837, 923
Bme18I GGWCC 1 cut(s) 404
BmgT120I GGNCC 1 cut(s) 404
BmiI GGNNCC 2 cut(s) 194, 405
BmrFI CCNGG 5 cut(s) 125, 408, 733, 837, 923
BmsI GCATC 4 cut(s) 226, 444, 586, 703
BpmI CTGGAG 2 cut(s) 429, 905
BpuMI CCSGG 1 cut(s) 837
BsaAI YACGTR 2 cut(s) 42, 695
BsaI GGTCTC 2 cut(s) 533, 811
BsaJI CCNNGG 4 cut(s) 124, 731, 732, 922
BsaWI WCCGGW 1 cut(s) 438
Bsc4I CCNNNNNNNGG 1 cut(s) 130
Bse1I ACTGG 1 cut(s) 882
Bse3DI GCAATG 1 cut(s) 55
BseAI TCCGGA 1 cut(s) 438
BseBI CCWGG 4 cut(s) 125, 408, 733, 923
BseDI CCNNGG 4 cut(s) 124, 731, 732, 922
BseGI GGATG 2 cut(s) 435, 601
BseLI CCNNNNNNNGG 1 cut(s) 130
BseMI GCAATG 1 cut(s) 55
BseMII CTCAG 1 cut(s) 576
BseNI ACTGG 1 cut(s) 882
BseRI GAGGAG 2 cut(s) 426, 857
BseXI GCAGC 3 cut(s) 375, 790, 793
BshFI GGCC 1 cut(s) 367
BsiSI CCGG 3 cut(s) 385, 439, 837
BslFI GGGAC 1 cut(s) 417
BslI CCNNNNNNNGG 1 cut(s) 130
BsmAI GTCTC 2 cut(s) 533, 811
BsmFI GGGAC 1 cut(s) 417
BsnI GGCC 1 cut(s) 367
Bso31I GGTCTC 2 cut(s) 533, 811
Bsp13I TCCGGA 1 cut(s) 438
Bsp143I GATC 5 cut(s) 192, 280, 415, 664, 904
BspANI GGCC 1 cut(s) 367
BspCNI CTCAG 1 cut(s) 577
BspEI TCCGGA 1 cut(s) 438
BspHI TCATGA 1 cut(s) 667
BspLI GGNNCC 2 cut(s) 194, 405
BspPI GGATC 5 cut(s) 187, 200, 275, 672, 899
BspTI CTTAAG 1 cut(s) 335
BspTNI GGTCTC 2 cut(s) 533, 811
BsrDI GCAATG 1 cut(s) 55
BsrI ACTGG 1 cut(s) 882
BssECI CCNNGG 4 cut(s) 124, 731, 732, 922
BssMI GATC 5 cut(s) 192, 280, 415, 664, 904
Bst2UI CCWGG 4 cut(s) 125, 408, 733, 923
Bst4CI ACNGT 2 cut(s) 13, 890
Bst6I CTCTTC 1 cut(s) 671
BstAFI CTTAAG 1 cut(s) 335
BstBAI YACGTR 2 cut(s) 42, 695
BstC8I GCNNGC 1 cut(s) 53
BstDEI CTNAG 3 cut(s) 26, 585, 635
BstF5I GGATG 2 cut(s) 435, 601
BstKTI GATC 5 cut(s) 195, 283, 418, 667, 907
BstMAI GTCTC 2 cut(s) 533, 811
BstMBI GATC 5 cut(s) 192, 280, 415, 664, 904
BstMWI GCNNNNNNNGC 2 cut(s) 57, 66
BstNI CCWGG 4 cut(s) 125, 408, 733, 923
BstNSI RCATGY 1 cut(s) 565
BstSCI CCNGG 5 cut(s) 123, 406, 731, 835, 921
BstSFI CTRYAG 1 cut(s) 889
BstSNI TACGTA 1 cut(s) 695
BstV1I GCAGC 3 cut(s) 375, 790, 793
BstX2I RGATCY 2 cut(s) 192, 415
BstYI RGATCY 2 cut(s) 192, 415
BsuI GTATCC 1 cut(s) 25
BsuRI GGCC 1 cut(s) 367
BtsCI GGATG 2 cut(s) 435, 601
Cac8I GCNNGC 1 cut(s) 53
CaiI CAGNNNCTG 2 cut(s) 716, 888
CciI TCATGA 1 cut(s) 667
Cfr13I GGNCC 1 cut(s) 404
Csp6I GTAC 2 cut(s) 582, 778
CviAII CATG 5 cut(s) 101, 111, 242, 562, 668
CviQI GTAC 2 cut(s) 582, 778
DdeI CTNAG 3 cut(s) 26, 585, 635
DpnI GATC 5 cut(s) 194, 282, 417, 666, 906
DpnII GATC 5 cut(s) 192, 280, 415, 664, 904
Eam1104I CTCTTC 1 cut(s) 671
EarI CTCTTC 1 cut(s) 671
Eco105I TACGTA 1 cut(s) 695
Eco31I GGTCTC 2 cut(s) 533, 811
Eco47I GGWCC 1 cut(s) 404
Eco57I CTGAAG 1 cut(s) 366
EcoO109I RGGNCCY 1 cut(s) 404
EcoRII CCWGG 4 cut(s) 123, 406, 731, 921
FaeI CATG 5 cut(s) 104, 114, 245, 565, 671
FalI AAGNNNNNCTT 2 cut(s) 690, 722
FaqI GGGAC 1 cut(s) 417
FatI CATG 5 cut(s) 100, 110, 241, 561, 667
FauNDI CATATG 1 cut(s) 786
FblI GTMKAC 1 cut(s) 621
Fnu4HI GCNGC 3 cut(s) 389, 804, 807
FokI GGATG 2 cut(s) 422, 608
Fsp4HI GCNGC 3 cut(s) 389, 804, 807
FspBI CTAG 1 cut(s) 252
GluI GCNGC 3 cut(s) 389, 804, 807
GsuI CTGGAG 2 cut(s) 429, 905
HaeIII GGCC 1 cut(s) 367
HapII CCGG 3 cut(s) 385, 439, 837
Hin1II CATG 5 cut(s) 104, 114, 245, 565, 671
HincII GTYRAC 2 cut(s) 426, 622
HindII GTYRAC 2 cut(s) 426, 622
HinfI GANTC 3 cut(s) 331, 611, 727
HpaII CCGG 3 cut(s) 385, 439, 837
Hpy166II GTNNAC 2 cut(s) 426, 622
Hpy188I TCNGA 4 cut(s) 420, 454, 508, 616
Hpy188III TCNNGA 6 cut(s) 233, 439, 554, 662, 668, 710
Hpy8I GTNNAC 2 cut(s) 426, 622
HpyAV CCTTC 4 cut(s) 524, 736, 849, 888
HpyCH4III ACNGT 2 cut(s) 13, 890
HpyCH4IV ACGT 4 cut(s) 41, 476, 577, 694
HpyCH4V TGCA 3 cut(s) 239, 565, 656
HpyF10VI GCNNNNNNNGC 2 cut(s) 57, 66
HpyF3I CTNAG 3 cut(s) 26, 585, 635
HpySE526I ACGT 4 cut(s) 41, 476, 577, 694
Hsp92II CATG 5 cut(s) 104, 114, 245, 565, 671
Kpn2I TCCGGA 1 cut(s) 438
Kzo9I GATC 5 cut(s) 192, 280, 415, 664, 904
LmnI GCTCC 2 cut(s) 267, 862
Lsp1109I GCAGC 3 cut(s) 375, 790, 793
LweI GCATC 4 cut(s) 226, 444, 586, 703
MaeI CTAG 1 cut(s) 252
MaeII ACGT 4 cut(s) 41, 476, 577, 694
MaeIII GTNAC 2 cut(s) 103, 884
MalI GATC 5 cut(s) 194, 282, 417, 666, 906
MboI GATC 5 cut(s) 192, 280, 415, 664, 904
MboII GAAGA 5 cut(s) 127, 359, 362, 685, 688
MflI RGATCY 2 cut(s) 192, 415
MluCI AATT 5 cut(s) 134, 180, 198, 212, 657
MmeI TCCRAC 1 cut(s) 320
MnlI CCTC 9 cut(s) 124, 180, 404, 554, 610, 793, 835, 845, 918
MroI TCCGGA 1 cut(s) 438
MroXI GAANNNNTTC 1 cut(s) 464
MseI TTAA 3 cut(s) 165, 336, 357
MslI CAYNNNNRTG 1 cut(s) 60
MspA1I CMGCKG 2 cut(s) 51, 872
MspCI CTTAAG 1 cut(s) 335
MspI CCGG 3 cut(s) 385, 439, 837
MspR9I CCNGG 5 cut(s) 125, 408, 733, 837, 923
MvaI CCWGG 4 cut(s) 125, 408, 733, 923
MwoI GCNNNNNNNGC 2 cut(s) 57, 66
NciI CCSGG 1 cut(s) 837
NdeI CATATG 1 cut(s) 786
NdeII GATC 5 cut(s) 192, 280, 415, 664, 904
NlaIII CATG 5 cut(s) 104, 114, 245, 565, 671
NlaIV GGNNCC 2 cut(s) 194, 405
NspI RCATGY 1 cut(s) 565
PagI TCATGA 1 cut(s) 667
PasI CCCWGGG 1 cut(s) 732
PdmI GAANNNNTTC 1 cut(s) 464
PfeI GAWTC 3 cut(s) 331, 611, 727
PkrI GCNGC 3 cut(s) 390, 805, 808
Ppu21I YACGTR 2 cut(s) 42, 695
PpuMI RGGWCCY 1 cut(s) 404
Psp1406I AACGTT 1 cut(s) 577
Psp5II RGGWCCY 1 cut(s) 404
Psp6I CCWGG 4 cut(s) 123, 406, 731, 921
PspGI CCWGG 4 cut(s) 123, 406, 731, 921
PspN4I GGNNCC 2 cut(s) 194, 405
PspPI GGNCC 1 cut(s) 404
PspPPI RGGWCCY 1 cut(s) 404
PstNI CAGNNNCTG 2 cut(s) 716, 888
PsuI RGATCY 2 cut(s) 192, 415
PvuII CAGCTG 2 cut(s) 51, 872
RsaI GTAC 2 cut(s) 583, 779
RsaNI GTAC 2 cut(s) 582, 778
RseI CAYNNNNRTG 1 cut(s) 60
SalI GTCGAC 1 cut(s) 620
SaqAI TTAA 3 cut(s) 165, 336, 357
SatI GCNGC 3 cut(s) 389, 804, 807
Sau3AI GATC 5 cut(s) 192, 280, 415, 664, 904
Sau96I GGNCC 1 cut(s) 404
ScrFI CCNGG 5 cut(s) 125, 408, 733, 837, 923
SfaNI GCATC 4 cut(s) 226, 444, 586, 703
SfcI CTRYAG 1 cut(s) 889
SinI GGWCC 1 cut(s) 404
SmiMI CAYNNNNRTG 1 cut(s) 60
SmlI CTYRAG 1 cut(s) 335
SmoI CTYRAG 1 cut(s) 335
SnaBI TACGTA 1 cut(s) 695
Sse9I AATT 5 cut(s) 134, 180, 198, 212, 657
SspMI CTAG 1 cut(s) 252
StyD4I CCNGG 5 cut(s) 123, 406, 731, 835, 921
TaaI ACNGT 2 cut(s) 13, 890
TaiI ACGT 4 cut(s) 44, 479, 580, 697
TaqI TCGA 3 cut(s) 546, 621, 910
TasI AATT 5 cut(s) 134, 180, 198, 212, 657
TatI WGTACW 2 cut(s) 581, 777
TfiI GAWTC 3 cut(s) 331, 611, 727
Tru1I TTAA 3 cut(s) 165, 336, 357
Tru9I TTAA 3 cut(s) 165, 336, 357
TseI GCWGC 3 cut(s) 388, 803, 806
Vha464I CTTAAG 1 cut(s) 335
VpaK11BI GGWCC 1 cut(s) 404
XceI RCATGY 1 cut(s) 565
XmiI GTMKAC 1 cut(s) 621
XmnI GAANNNNTTC 1 cut(s) 464
XspI CTAG 1 cut(s) 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.