Rroxscaffold_5G00348000

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
19840855 .. 19845304
4450 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00348000.1

Sequence Viewer

Length: 249 bp
ATGGGGTTTGCTGGAGACGACGAAGAAGGATCGACAAATAAACGATTGGCTCTTTGTATTTCTGGGTCTTGGACTTCATCCCAATGTTTGTGTTTTCAGAGTTGTCAGAAGACTTTAAATATAGATACAACCAGAGGCCGCAAAGAAAAATCTCACATTTATTCCTCTAGCACCAGCTTGTGTGATTCTGGATTTGCAAATGTAGATTGTGGAATTCCTTCAGTGTTGAAGTATGATTGGAAGAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

8.98

Weight (kDa)

6.52

Isoelectric Point (pI)

49.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 139
AclWI GGATC 1 cut(s) 37
AcsI RAATTY 1 cut(s) 213
AcuI CTGAAG 1 cut(s) 204
AgsI TTSAA 1 cut(s) 229
AluBI AGCT 1 cut(s) 177
AluI AGCT 1 cut(s) 177
Alw26I GTCTC 1 cut(s) 9
AlwI GGATC 1 cut(s) 37
AoxI GGCC 1 cut(s) 136
ApoI RAATTY 1 cut(s) 213
Asp700I GAANNNNTTC 1 cut(s) 217
BbsI GAAGAC 1 cut(s) 116
BcoDI GTCTC 1 cut(s) 9
BfaI CTAG 1 cut(s) 168
BisI GCNGC 1 cut(s) 139
BlsI GCNGC 1 cut(s) 140
BpiI GAAGAC 1 cut(s) 116
BpmI CTGGAG 1 cut(s) 33
BseGI GGATG 1 cut(s) 77
BshFI GGCC 1 cut(s) 138
BsmAI GTCTC 1 cut(s) 9
BsmBI CGTCTC 1 cut(s) 9
BsnI GGCC 1 cut(s) 138
Bsp143I GATC 1 cut(s) 29
BspACI CCGC 1 cut(s) 139
BspANI GGCC 1 cut(s) 138
BspPI GGATC 1 cut(s) 37
BssMI GATC 1 cut(s) 29
BstF5I GGATG 1 cut(s) 77
BstKTI GATC 1 cut(s) 32
BstMAI GTCTC 1 cut(s) 9
BstMBI GATC 1 cut(s) 29
BstV2I GAAGAC 1 cut(s) 116
BsuRI GGCC 1 cut(s) 138
BtsCI GGATG 1 cut(s) 77
BtsIMutI CAGTG 1 cut(s) 228
CviJI RGCY 3 cut(s) 50, 138, 177
CviKI_1 RGCY 3 cut(s) 50, 138, 177
DpnI GATC 1 cut(s) 31
DpnII GATC 1 cut(s) 29
DraI TTTAAA 1 cut(s) 117
Eco57I CTGAAG 1 cut(s) 204
EcoRI GAATTC 1 cut(s) 213
Esp3I CGTCTC 1 cut(s) 9
FaiI YATR 2 cut(s) 122, 234
Fnu4HI GCNGC 1 cut(s) 139
FokI GGATG 1 cut(s) 64
Fsp4HI GCNGC 1 cut(s) 139
FspBI CTAG 1 cut(s) 168
GluI GCNGC 1 cut(s) 139
GsuI CTGGAG 1 cut(s) 33
HaeIII GGCC 1 cut(s) 138
HinfI GANTC 1 cut(s) 185
Hpy188I TCNGA 2 cut(s) 99, 108
Hpy188III TCNNGA 1 cut(s) 189
Hpy99I CGWCG 1 cut(s) 23
HpyAV CCTTC 2 cut(s) 20, 228
HpyCH4V TGCA 1 cut(s) 197
Kzo9I GATC 1 cut(s) 29
LpnPI CCDG 4 cut(s) 48, 145, 174, 187
MaeI CTAG 1 cut(s) 168
MalI GATC 1 cut(s) 31
MboI GATC 1 cut(s) 29
MboII GAAGA 2 cut(s) 35, 121
MluCI AATT 2 cut(s) 213, 244
MnlI CCTC 2 cut(s) 128, 175
MroXI GAANNNNTTC 1 cut(s) 217
MseI TTAA 1 cut(s) 116
MslI CAYNNNNRTG 1 cut(s) 82
NdeII GATC 1 cut(s) 29
PdmI GAANNNNTTC 1 cut(s) 217
PfeI GAWTC 1 cut(s) 185
PkrI GCNGC 1 cut(s) 140
RseI CAYNNNNRTG 1 cut(s) 82
SaqAI TTAA 1 cut(s) 116
SatI GCNGC 1 cut(s) 139
Sau3AI GATC 1 cut(s) 29
SetI ASST 1 cut(s) 179
SgeI CNNG 8 cut(s) 24, 75, 81, 144, 180, 186, 190, 201
SmiMI CAYNNNNRTG 1 cut(s) 82
Sse9I AATT 2 cut(s) 213, 244
SsiI CCGC 1 cut(s) 139
SspMI CTAG 1 cut(s) 168
TaqI TCGA 1 cut(s) 32
TasI AATT 2 cut(s) 213, 244
TauI GCSGC 1 cut(s) 141
TfiI GAWTC 1 cut(s) 185
Tru1I TTAA 1 cut(s) 116
Tru9I TTAA 1 cut(s) 116
TscAI CASTG 1 cut(s) 228
TspDTI ATGAA 1 cut(s) 66
TspRI CASTG 1 cut(s) 228
XapI RAATTY 1 cut(s) 213
XmnI GAANNNNTTC 1 cut(s) 217
XspI CTAG 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.