Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr07

Orthogroup ID

OG0000722

Physical Location & Seq

Genomic Coordinates Reverse (-)

10480436 .. 10480918

Gene Structure 483 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD07G1096300.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 483 bp

ATGGGGAATTGGTTTTGGTCAATTCCAGTGTTGTTAAAAGAAAATGAGACTGAATTACACGATTTGGTGAGCAAAATGAGGCAAGGAGTGACAGAATTTCGCAATGAGAAGGCCAGCAGATTTAAAGGTGAGGATGGATTCTTAGTGGTATCTGAGTCTCTAAGAGAGAGGACTGATATTTTTAATAGCAATAACATCGTAAATGTTTATAAAACCACAAGTTTGTGCCAGCTTCCTCTGTATGAAATGGATTTTGGATGGGAGAAACCTGCGTGGGTCACCAGCCTAAGTGCCCTCAAGAACATAATTGTTTTGGTTGCCACAAAAGAGCAAGATGGTATCGAAGCTTGGGTGACCCTGGATGAACAAGAAATGGCCATATTTGAGTCTGATCAAGAGCTTCTTGCATTTTGTTCCGTCAACCCCAGCATTGACCATTCAGGGTTGGTCCTGGGTTTTCCAAGGCCCATGGCGAGGATCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0006807 GO:0008150 GO:0008152 GO:0009820 GO:0016740 GO:0016746 GO:0016747 GO:0050636 GO:0071704 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko00940 ko00941 ko00945 ko01100 ko01110 map00940 map00941 map00945 map01100 map01110

Pfam Domains

Protein Families

Transferase

Protein Analysis

161

Amino Acids

18.29

Weight (kDa)

4.72

Isoelectric Point (pI)

34.82

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Transferase	PF02458	2 - 134	1.7e-14	Transferase family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000722)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g27601 FvH4_4g17130
malus_domestica	MD07G1048300.v1.1 MD07G1095200.v1.1 MD07G1095500.v1.1 MD07G1095700.v1.1 MD07G1096300.v1.1 MD07G1096400.v1.1 MD09G1062300.v1.1 MD14G1082000.v1.1
prunus_persica	Prupe.7G029300_v2.0.a1 Prupe.7G030000_v2.0.a1
pyrus_communis	pycom07g07870 pycom07g07910 pycom07g07950 pycom111g05260 pycom14g07130 pycom17g05610
rosa_chinensis	RchiOBHm_Chr1g0325581 RchiOBHm_Chr3g0487911 RchiOBHm_Chr3g0487931 RchiOBHm_Chr3g0487961 RchiOBHm_Chr3g0487971 RchiOBHm_Chr7g0216431 RchiOBHm_Chr7g0216441
rosa_laevigata	RLG00000002570 RLG00000003149 RLG00000022955 RLG00000022960 RLG00000022961 RLG00000022964 RLG00000022965 RLG00000022966 RLG00000030119 RLG00000030129
rosa_multiflora	Rmu_sc0004155.1_g000011 Rmu_sc0004448.1_g000015 Rmu_sc0004448.1_g000025 Rmu_sc0004448.1_g000031 Rmu_sc0006722.1_g000006
rosa_roxburghii	Rroxscaffold_3G00243230 Rroxscaffold_3G00243240 Rroxscaffold_3G00250720 Rroxscaffold_3G00252280 Rroxscaffold_4G00324640 Rroxscaffold_6G00394390 Rroxscaffold_6G00394400 Rroxscaffold_6G00394430 Rroxscaffold_6G00394440
rosa_rugosa	Rorug01G0053000 Rorug03G0237300 Rorug03G0237400 Rorug07G0160300 Rorug07G0160300 Rorug07G0160300
rosa_samantha	Rh1BG056200 Rh1DG073800 Rh3AG285000 Rh3AG285200 Rh3AG285400 Rh3CG320500 Rh3CG320800 Rh3DG318900 Rh3DG319000 Rh7AG299400 Rh7AG299500 Rh7BG290900 Rh7DG300800
rosa_wichuraiana	Rw0G004660 Rw0G004670 Rw1G005690 Rw3G025280 Rw7G025450

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	210
Acc36I	ACCTGC	1 cut(s)	277
AcoI	YGGCCR	1 cut(s)	375
AcsI	RAATTY	1 cut(s)	95
AfiI	CCNNNNNNNGG	1 cut(s)	474
AjnI	CCWGG	2 cut(s)	357, 450
AjuI	GAANNNNNNNTTGG	2 cut(s)	237, 269
AluBI	AGCT	3 cut(s)	232, 347, 400
AluI	AGCT	3 cut(s)	232, 347, 400
Alw26I	GTCTC	2 cut(s)	41, 162
AoxI	GGCC	3 cut(s)	111, 375, 464
ApoI	RAATTY	1 cut(s)	95
AspS9I	GGNCC	2 cut(s)	448, 465
AsuHPI	GGTGA	4 cut(s)	79, 140, 271, 364
AvaII	GGWCC	1 cut(s)	448
BaeGI	GKGCMC	1 cut(s)	295
BalI	TGGCCA	1 cut(s)	377
BccI	CCATC	3 cut(s)	128, 252, 329
BcgI	CGANNNNNNTGC	2 cut(s)	178, 212
BciT130I	CCWGG	2 cut(s)	359, 452
BclI	TGATCA	1 cut(s)	391
BcoDI	GTCTC	2 cut(s)	41, 162
BfuAI	ACCTGC	1 cut(s)	277
Bme1390I	CCNGG	2 cut(s)	359, 452
Bme18I	GGWCC	1 cut(s)	448
BmgT120I	GGNCC	2 cut(s)	448, 465
BmrFI	CCNGG	2 cut(s)	359, 452
BpuEI	CTTGAG	1 cut(s)	281
BsaJI	CCNNGG	4 cut(s)	357, 451, 461, 468
Bsc4I	CCNNNNNNNGG	1 cut(s)	474
Bse1I	ACTGG	1 cut(s)	26
Bse3DI	GCAATG	1 cut(s)	109
BseBI	CCWGG	2 cut(s)	359, 452
BseDI	CCNNGG	4 cut(s)	357, 451, 461, 468
BseGI	GGATG	3 cut(s)	139, 263, 367
BseLI	CCNNNNNNNGG	1 cut(s)	474
BseMI	GCAATG	1 cut(s)	109
BseMII	CTCAG	1 cut(s)	144
BseNI	ACTGG	1 cut(s)	26
BseSI	GKGCMC	1 cut(s)	295
BseYI	CCCAGC	1 cut(s)	425
BshFI	GGCC	3 cut(s)	113, 377, 466
BslI	CCNNNNNNNGG	1 cut(s)	474
BsmAI	GTCTC	2 cut(s)	41, 162
BsnI	GGCC	3 cut(s)	113, 377, 466
Bsp1286I	GDGCHC	1 cut(s)	295
Bsp143I	GATC	2 cut(s)	391, 477
Bsp19I	CCATGG	1 cut(s)	468
BspANI	GGCC	3 cut(s)	113, 377, 466
BspCNI	CTCAG	1 cut(s)	145
BspMI	ACCTGC	1 cut(s)	277
BsrDI	GCAATG	1 cut(s)	109
BsrI	ACTGG	1 cut(s)	26
BssECI	CCNNGG	4 cut(s)	357, 451, 461, 468
BssMI	GATC	2 cut(s)	391, 477
BssT1I	CCWWGG	2 cut(s)	461, 468
Bst2UI	CCWGG	2 cut(s)	359, 452
BstC8I	GCNNGC	2 cut(s)	115, 230
BstDEI	CTNAG	4 cut(s)	142, 153, 161, 287
BstDSI	CCRYGG	1 cut(s)	468
BstEII	GGTNACC	2 cut(s)	277, 352
BstF5I	GGATG	3 cut(s)	139, 263, 367
BstKTI	GATC	2 cut(s)	394, 480
BstMAI	GTCTC	2 cut(s)	41, 162
BstMBI	GATC	2 cut(s)	391, 477
BstNI	CCWGG	2 cut(s)	359, 452
BstPI	GGTNACC	2 cut(s)	277, 352
BstSCI	CCNGG	2 cut(s)	357, 450
BstSLI	GKGCMC	1 cut(s)	295
BstX2I	RGATCY	1 cut(s)	477
BstYI	RGATCY	1 cut(s)	477
BsuRI	GGCC	3 cut(s)	113, 377, 466
BtgI	CCRYGG	1 cut(s)	468
BtsCI	GGATG	3 cut(s)	139, 263, 367
BtsIMutI	CAGTG	1 cut(s)	33
BveI	ACCTGC	1 cut(s)	277
Cac8I	GCNNGC	2 cut(s)	115, 230
Cfr13I	GGNCC	2 cut(s)	448, 465
CviAII	CATG	1 cut(s)	469
CviJI	RGCY	7 cut(s)	113, 232, 285, 347, 377, 400, 466
CviKI_1	RGCY	7 cut(s)	113, 232, 285, 347, 377, 400, 466
DdeI	CTNAG	4 cut(s)	142, 153, 161, 287
DpnI	GATC	2 cut(s)	393, 479
DpnII	GATC	2 cut(s)	391, 477
DraI	TTTAAA	1 cut(s)	124
EaeI	YGGCCR	1 cut(s)	375
Eco130I	CCWWGG	2 cut(s)	461, 468
Eco47I	GGWCC	1 cut(s)	448
Eco91I	GGTNACC	2 cut(s)	277, 352
EcoO65I	GGTNACC	2 cut(s)	277, 352
EcoRII	CCWGG	2 cut(s)	357, 450
EcoT14I	CCWWGG	2 cut(s)	461, 468
ErhI	CCWWGG	2 cut(s)	461, 468
FaeI	CATG	1 cut(s)	472
FaiI	YATR	5 cut(s)	210, 243, 305, 380, 470
FalI	AAGNNNNNCTT	2 cut(s)	387, 419
FatI	CATG	1 cut(s)	468
FbaI	TGATCA	1 cut(s)	391
FokI	GGATG	3 cut(s)	146, 270, 374
GsaI	CCCAGC	1 cut(s)	429
HaeIII	GGCC	3 cut(s)	113, 377, 466
Hin1II	CATG	1 cut(s)	472
HincII	GTYRAC	1 cut(s)	421
HindII	GTYRAC	1 cut(s)	421
HindIII	AAGCTT	1 cut(s)	345
HinfI	GANTC	3 cut(s)	138, 155, 386
HphI	GGTGA	4 cut(s)	79, 140, 271, 364
Hpy166II	GTNNAC	1 cut(s)	421
Hpy188I	TCNGA	2 cut(s)	154, 391
Hpy188III	TCNNGA	2 cut(s)	298, 395
Hpy8I	GTNNAC	1 cut(s)	421
HpyAV	CCTTC	1 cut(s)	103
HpyCH4V	TGCA	1 cut(s)	407
HpyF3I	CTNAG	4 cut(s)	142, 153, 161, 287
Hsp92II	CATG	1 cut(s)	472
Ksp22I	TGATCA	1 cut(s)	391
Kzo9I	GATC	2 cut(s)	391, 477
MaeIII	GTNAC	3 cut(s)	88, 277, 352
MalI	GATC	2 cut(s)	393, 479
MboI	GATC	2 cut(s)	391, 477
MflI	RGATCY	1 cut(s)	477
MhlI	GDGCHC	1 cut(s)	295
MlsI	TGGCCA	1 cut(s)	377
MluCI	AATT	5 cut(s)	7, 21, 53, 95, 306
MluNI	TGGCCA	1 cut(s)	377
MlyI	GAGTC	2 cut(s)	164, 395
MnlI	CCTC	6 cut(s)	72, 124, 162, 246, 305, 468
Mox20I	TGGCCA	1 cut(s)	377
MscI	TGGCCA	1 cut(s)	377
MseI	TTAA	3 cut(s)	35, 123, 183
Msp20I	TGGCCA	1 cut(s)	377
MspR9I	CCNGG	2 cut(s)	359, 452
MvaI	CCWGG	2 cut(s)	359, 452
NcoI	CCATGG	1 cut(s)	468
NdeII	GATC	2 cut(s)	391, 477
NlaIII	CATG	1 cut(s)	472
NmuCI	GTSAC	3 cut(s)	88, 277, 352
PfeI	GAWTC	1 cut(s)	138
PleI	GAGTC	2 cut(s)	163, 394
PpsI	GAGTC	2 cut(s)	163, 394
PsiI	TTATAA	1 cut(s)	210
Psp6I	CCWGG	2 cut(s)	357, 450
PspEI	GGTNACC	2 cut(s)	277, 352
PspFI	CCCAGC	1 cut(s)	425
PspGI	CCWGG	2 cut(s)	357, 450
PspPI	GGNCC	2 cut(s)	448, 465
PsuI	RGATCY	1 cut(s)	477
SaqAI	TTAA	3 cut(s)	35, 123, 183
Sau3AI	GATC	2 cut(s)	391, 477
Sau96I	GGNCC	2 cut(s)	448, 465
SchI	GAGTC	2 cut(s)	164, 395
ScrFI	CCNGG	2 cut(s)	359, 452
SduI	GDGCHC	1 cut(s)	295
SetI	ASST	5 cut(s)	130, 234, 271, 349, 402
SinI	GGWCC	1 cut(s)	448
SmlI	CTYRAG	1 cut(s)	296
SmoI	CTYRAG	1 cut(s)	296
Sse9I	AATT	5 cut(s)	7, 21, 53, 95, 306
StyD4I	CCNGG	2 cut(s)	357, 450
StyI	CCWWGG	2 cut(s)	461, 468
TaqI	TCGA	1 cut(s)	342
TasI	AATT	5 cut(s)	7, 21, 53, 95, 306
TfiI	GAWTC	1 cut(s)	138
Tru1I	TTAA	3 cut(s)	35, 123, 183
Tru9I	TTAA	3 cut(s)	35, 123, 183
TscAI	CASTG	1 cut(s)	33
TseFI	GTSAC	3 cut(s)	88, 277, 352
Tsp45I	GTSAC	3 cut(s)	88, 277, 352
TspDTI	ATGAA	2 cut(s)	258, 378
TspGWI	ACGGA	1 cut(s)	406
TspRI	CASTG	1 cut(s)	33
VpaK11BI	GGWCC	1 cut(s)	448
XapI	RAATTY	1 cut(s)	95

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.