Prupe.1G182200_v2.0.a1

Extensin-2-like

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
16026957 .. 16027555
599 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G182200.1

Sequence Viewer

Length: 462 bp
ATGACGACAATGGGTGGCGGCTCCTCTTGGGGCCGTCTTTGGCCTCAAATGGCAGTGGCTTTAGCAGCTATACTAGTTGTGGTTTCAAGCAATGTGGGTTCAGTTGAAGCAAATGCTTATCCCTACTCTTCACCCCCACCACCACCTTATGTTTATAGCTCACCACCACCTCCTGTTCACTCTCCACCACCGCCATATGTCTACATGTCTCCACCACCTCCGTCACCGTCACCACCGCCGCCTTATGTGTACAAGTCACCACCACCACCATCACCATCCCCACCACCGACTTATGAGTACAAGTCTCCCCCACCGCCTTCTCCTTCACCACCACCACCTTATGTGTACAAGTCTCCACCTCCTCCACCAAAAGAACTACCTCCGTACCACTACAAGTCTCCACCACCACCTTCTCCTTCACCGCCGCCACCTTACCACTATACATCTCCTCAACGTGTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

154

Amino Acids

16.36

Weight (kDa)

9.22

Isoelectric Point (pI)

141.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 201
AciI CCGC 7 cut(s) 18, 191, 236, 239, 314, 422, 425
AfaI GTAC 4 cut(s) 251, 299, 347, 386
AflIII ACRYGT 2 cut(s) 204, 454
AgsI TTSAA 2 cut(s) 87, 107
AhlI ACTAGT 1 cut(s) 73
AluBI AGCT 2 cut(s) 68, 159
AluI AGCT 2 cut(s) 68, 159
Alw26I GTCTC 4 cut(s) 213, 309, 357, 402
AoxI GGCC 2 cut(s) 31, 41
ApeKI GCWGC 1 cut(s) 65
AspS9I GGNCC 1 cut(s) 31
AsuHPI GGTGA 8 cut(s) 123, 153, 216, 222, 249, 264, 318, 411
BaeI ACNNNNGTAYC 2 cut(s) 368, 401
BbvI GCAGC 1 cut(s) 77
BccI CCATC 2 cut(s) 277, 283
BceAI ACGGC 1 cut(s) 18
BcoDI GTCTC 4 cut(s) 213, 309, 357, 402
BcuI ACTAGT 1 cut(s) 73
BfaI CTAG 1 cut(s) 74
BisI GCNGC 4 cut(s) 19, 66, 239, 425
BlsI GCNGC 4 cut(s) 20, 67, 240, 426
BmgT120I GGNCC 1 cut(s) 31
BmiI GGNNCC 2 cut(s) 22, 32
Bse3DI GCAATG 1 cut(s) 97
BseGI GGATG 1 cut(s) 275
BseMI GCAATG 1 cut(s) 97
BseRI GAGGAG 3 cut(s) 13, 351, 438
BseXI GCAGC 1 cut(s) 77
BshFI GGCC 2 cut(s) 33, 43
BsmAI GTCTC 4 cut(s) 213, 309, 357, 402
BsnI GGCC 2 cut(s) 33, 43
Bsp1407I TGTACA 2 cut(s) 249, 345
BspACI CCGC 7 cut(s) 18, 191, 236, 239, 314, 422, 425
BspANI GGCC 2 cut(s) 33, 43
BspLI GGNNCC 2 cut(s) 22, 32
BsrDI GCAATG 1 cut(s) 97
BsrGI TGTACA 2 cut(s) 249, 345
Bst4CI ACNGT 1 cut(s) 228
Bst6I CTCTTC 1 cut(s) 133
BstAUI TGTACA 2 cut(s) 249, 345
BstF5I GGATG 1 cut(s) 275
BstMAI GTCTC 4 cut(s) 213, 309, 357, 402
BstMWI GCNNNNNNNGC 1 cut(s) 65
BstNSI RCATGY 1 cut(s) 208
BstV1I GCAGC 1 cut(s) 77
BsuRI GGCC 2 cut(s) 33, 43
BtsCI GGATG 1 cut(s) 275
BtsI GCAGTG 1 cut(s) 60
BtsIMutI CAGTG 1 cut(s) 60
Cfr13I GGNCC 1 cut(s) 31
Csp6I GTAC 4 cut(s) 250, 298, 346, 385
CspCI CAANNNNNGTGG 2 cut(s) 75, 110
CviAII CATG 1 cut(s) 205
CviJI RGCY 6 cut(s) 21, 33, 43, 59, 68, 159
CviKI_1 RGCY 6 cut(s) 21, 33, 43, 59, 68, 159
CviQI GTAC 4 cut(s) 250, 298, 346, 385
Eam1104I CTCTTC 1 cut(s) 133
EarI CTCTTC 1 cut(s) 133
FaeI CATG 1 cut(s) 208
FatI CATG 1 cut(s) 204
FauNDI CATATG 1 cut(s) 196
FblI GTMKAC 1 cut(s) 201
Fnu4HI GCNGC 4 cut(s) 19, 66, 239, 425
FokI GGATG 1 cut(s) 262
Fsp4HI GCNGC 4 cut(s) 19, 66, 239, 425
FspBI CTAG 1 cut(s) 74
GluI GCNGC 4 cut(s) 19, 66, 239, 425
HaeIII GGCC 2 cut(s) 33, 43
Hin1II CATG 1 cut(s) 208
HphI GGTGA 8 cut(s) 123, 153, 216, 222, 249, 264, 318, 411
Hpy166II GTNNAC 4 cut(s) 178, 202, 250, 346
Hpy188I TCNGA 1 cut(s) 461
Hpy8I GTNNAC 4 cut(s) 178, 202, 250, 346
HpyAV CCTTC 4 cut(s) 327, 333, 420, 426
HpyCH4III ACNGT 1 cut(s) 228
HpyCH4IV ACGT 1 cut(s) 454
HpyF10VI GCNNNNNNNGC 1 cut(s) 65
HpySE526I ACGT 1 cut(s) 454
Hsp92II CATG 1 cut(s) 208
LmnI GCTCC 1 cut(s) 26
LpnPI CCDG 1 cut(s) 186
Lsp1109I GCAGC 1 cut(s) 77
MaeI CTAG 1 cut(s) 74
MaeII ACGT 1 cut(s) 454
MaeIII GTNAC 3 cut(s) 222, 228, 255
MboII GAAGA 1 cut(s) 120
MnlI CCTC 8 cut(s) 34, 54, 180, 228, 369, 372, 390, 459
MwoI GCNNNNNNNGC 1 cut(s) 65
NdeI CATATG 1 cut(s) 196
NlaIII CATG 1 cut(s) 208
NlaIV GGNNCC 2 cut(s) 22, 32
NmuCI GTSAC 3 cut(s) 222, 228, 255
NspI RCATGY 1 cut(s) 208
PciI ACATGT 1 cut(s) 204
PkrI GCNGC 4 cut(s) 20, 67, 240, 426
PscI ACATGT 1 cut(s) 204
PspN4I GGNNCC 2 cut(s) 22, 32
PspPI GGNCC 1 cut(s) 31
RsaI GTAC 4 cut(s) 251, 299, 347, 386
RsaNI GTAC 4 cut(s) 250, 298, 346, 385
SatI GCNGC 4 cut(s) 19, 66, 239, 425
Sau96I GGNCC 1 cut(s) 31
SgeI CNNG 9 cut(s) 39, 86, 99, 185, 217, 265, 313, 361, 406
SpeI ACTAGT 1 cut(s) 73
SsiI CCGC 7 cut(s) 18, 191, 236, 239, 314, 422, 425
SspMI CTAG 1 cut(s) 74
TaaI ACNGT 1 cut(s) 228
TaiI ACGT 1 cut(s) 457
TatI WGTACW 3 cut(s) 249, 297, 345
TauI GCSGC 3 cut(s) 21, 241, 427
TscAI CASTG 1 cut(s) 60
TseFI GTSAC 3 cut(s) 222, 228, 255
TseI GCWGC 1 cut(s) 65
Tsp45I GTSAC 3 cut(s) 222, 228, 255
TspGWI ACGGA 2 cut(s) 210, 372
TspRI CASTG 1 cut(s) 60
XceI RCATGY 1 cut(s) 208
XmiI GTMKAC 1 cut(s) 201
XspI CTAG 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.