Rmu_co8377595.1_g000001

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8377595.1
Physical Location & Seq
Reverse (-)
118 .. 1152
1035 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8377595.1_g000001.1.cds

Sequence Viewer

Length: 344 bp
gacctgcgatcttagtctgttctattcgcttctgtattagacataggaaggaaaagaacaatacagatgttgaggccatcattcagaatattggacctctagcagtaaaaagatacaaattctcagatgtcagaaaaatgaccaactcctttgaagataaactgggtcaaggtggttatgttgatgtgtacaaaggtaagctattgaatggttgtcgtgtggctgtgaaggttcttaaagaatccaaagggaatggagaggactttgtcaatgaggttgcaagcattagtagaacttcccatgttaatgttgtcacactactagggtattgctttgaaggttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

113

Amino Acids

12.6

Weight (kDa)

9.29

Isoelectric Point (pI)

14.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 12
AcsI RAATTY 1 cut(s) 118
AfaI GTAC 1 cut(s) 190
AgsI TTSAA 3 cut(s) 154, 207, 337
AluBI AGCT 1 cut(s) 201
AluI AGCT 1 cut(s) 201
AoxI GGCC 1 cut(s) 74
ApoI RAATTY 1 cut(s) 118
AspS9I GGNCC 1 cut(s) 94
AvaII GGWCC 1 cut(s) 94
BccI CCATC 1 cut(s) 85
BfaI CTAG 2 cut(s) 100, 322
BfuAI ACCTGC 1 cut(s) 12
Bme18I GGWCC 1 cut(s) 94
BmgT120I GGNCC 1 cut(s) 94
BmrI ACTGGG 1 cut(s) 172
BmuI ACTGGG 1 cut(s) 172
Bse1I ACTGG 1 cut(s) 167
BseMII CTCAG 1 cut(s) 137
BseNI ACTGG 1 cut(s) 167
BshFI GGCC 1 cut(s) 76
BsnI GGCC 1 cut(s) 76
Bsp1407I TGTACA 1 cut(s) 188
Bsp143I GATC 1 cut(s) 8
BspANI GGCC 1 cut(s) 76
BspCNI CTCAG 1 cut(s) 136
BspMI ACCTGC 1 cut(s) 12
BsrGI TGTACA 1 cut(s) 188
BsrI ACTGG 1 cut(s) 167
BssMI GATC 1 cut(s) 8
BstAUI TGTACA 1 cut(s) 188
BstC8I GCNNGC 1 cut(s) 282
BstDEI CTNAG 2 cut(s) 12, 123
BstKTI GATC 1 cut(s) 11
BstMBI GATC 1 cut(s) 8
BsuRI GGCC 1 cut(s) 76
BveI ACCTGC 1 cut(s) 12
Cac8I GCNNGC 1 cut(s) 282
Cfr13I GGNCC 1 cut(s) 94
Csp6I GTAC 1 cut(s) 189
CviAII CATG 1 cut(s) 301
CviJI RGCY 3 cut(s) 76, 201, 223
CviKI_1 RGCY 3 cut(s) 76, 201, 223
CviQI GTAC 1 cut(s) 189
DdeI CTNAG 2 cut(s) 12, 123
DpnI GATC 1 cut(s) 10
DpnII GATC 1 cut(s) 8
Eco47I GGWCC 1 cut(s) 94
FaeI CATG 1 cut(s) 304
FaiI YATR 3 cut(s) 44, 179, 302
FatI CATG 1 cut(s) 300
FspBI CTAG 2 cut(s) 100, 322
HaeIII GGCC 1 cut(s) 76
Hin1II CATG 1 cut(s) 304
HinfI GANTC 1 cut(s) 241
Hpy166II GTNNAC 1 cut(s) 189
Hpy188I TCNGA 3 cut(s) 86, 126, 133
Hpy8I GTNNAC 1 cut(s) 189
HpyAV CCTTC 3 cut(s) 42, 222, 331
HpyCH4V TGCA 1 cut(s) 280
HpyF3I CTNAG 2 cut(s) 12, 123
Hsp92II CATG 1 cut(s) 304
Kzo9I GATC 1 cut(s) 8
LpnPI CCDG 2 cut(s) 17, 148
MaeI CTAG 2 cut(s) 100, 322
MaeIII GTNAC 1 cut(s) 312
MalI GATC 1 cut(s) 10
MboI GATC 1 cut(s) 8
MboII GAAGA 1 cut(s) 166
MluCI AATT 1 cut(s) 118
MnlI CCTC 4 cut(s) 66, 107, 252, 267
MseI TTAA 2 cut(s) 236, 305
MslI CAYNNNNRTG 1 cut(s) 305
NdeII GATC 1 cut(s) 8
NlaIII CATG 1 cut(s) 304
NmuCI GTSAC 1 cut(s) 312
PfeI GAWTC 1 cut(s) 241
PflFI GACNNNGTC 1 cut(s) 265
PspPI GGNCC 1 cut(s) 94
PsyI GACNNNGTC 1 cut(s) 265
RsaI GTAC 1 cut(s) 190
RsaNI GTAC 1 cut(s) 189
RseI CAYNNNNRTG 1 cut(s) 305
SaqAI TTAA 2 cut(s) 236, 305
Sau3AI GATC 1 cut(s) 8
Sau96I GGNCC 1 cut(s) 94
SetI ASST 8 cut(s) 6, 99, 174, 198, 203, 233, 278, 342
SgeI CNNG 8 cut(s) 16, 112, 175, 181, 229, 293, 313, 334
SinI GGWCC 1 cut(s) 94
SmiMI CAYNNNNRTG 1 cut(s) 305
Sse9I AATT 1 cut(s) 118
SspI AATATT 1 cut(s) 90
SspMI CTAG 2 cut(s) 100, 322
TasI AATT 1 cut(s) 118
TatI WGTACW 1 cut(s) 188
TfiI GAWTC 1 cut(s) 241
Tru1I TTAA 2 cut(s) 236, 305
Tru9I TTAA 2 cut(s) 236, 305
TseFI GTSAC 1 cut(s) 312
Tsp45I GTSAC 1 cut(s) 312
Tth111I GACNNNGTC 1 cut(s) 265
VpaK11BI GGWCC 1 cut(s) 94
XapI RAATTY 1 cut(s) 118
XspI CTAG 2 cut(s) 100, 322
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.