pycom13g21740

Belongs to the glucose-6-phosphate 1-epimerase family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
18679648 .. 18682472
2825 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 366 bp
ATGAGCAGCGACAAGGCTCCGAATCCAATCGCTGCTTCTGCTGCAGCATCTCCCACAAATGCATCCAGTAATACTACCACTGGCGGTGGTGGCTCTGCTGCCGTTGCTAATGCTAACGTAAGCCTTCATCCCGGCGTTGAATCCTGTAAGGGCATCAATGGCCTTGACAAGCTCGTCCTCCATGATCCACGAGGCAGTTCTGCTGAGGTGTATTTGTATGGGGCTCATGTAACTTCATGGAAGAATGATCATGGAGAGGAATTGCTGTTTGTTAGCAGTAAGGCTATCTTTAAGCCTCCAAAAGCAATTCGTGGGGGAATCCCGTTATGCTTTCCGCAAGTATTTTTCAAATCTTGGTCCTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

122

Amino Acids

12.45

Weight (kDa)

8.64

Isoelectric Point (pI)

23.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Aldose_epim PF01263 57 - 113 5.4e-11 Aldose 1-epimerase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 173
AciI CCGC 2 cut(s) 84, 335
AclWI GGATC 1 cut(s) 179
AgsI TTSAA 2 cut(s) 140, 349
AjuI GAANNNNNNNTTGG 2 cut(s) 19, 51
AluBI AGCT 1 cut(s) 172
AluI AGCT 1 cut(s) 172
AlwI GGATC 1 cut(s) 179
AoxI GGCC 1 cut(s) 160
ApeKI GCWGC 5 cut(s) 6, 32, 41, 44, 98
AspS9I GGNCC 1 cut(s) 357
AsuC2I CCSGG 1 cut(s) 132
AvaII GGWCC 1 cut(s) 357
BanII GRGCYC 1 cut(s) 226
BauI CACGAG 1 cut(s) 189
BbvCI CCTCAGC 1 cut(s) 204
BbvI GCAGC 5 cut(s) 18, 19, 28, 56, 85
BceAI ACGGC 1 cut(s) 86
BclI TGATCA 1 cut(s) 247
BcnI CCSGG 1 cut(s) 132
BfmI CTRYAG 1 cut(s) 42
BisI GCNGC 5 cut(s) 7, 33, 42, 45, 99
BlsI GCNGC 5 cut(s) 8, 34, 43, 46, 100
Bme1390I CCNGG 1 cut(s) 132
Bme18I GGWCC 1 cut(s) 357
BmgT120I GGNCC 1 cut(s) 357
BmiI GGNNCC 1 cut(s) 18
BmrFI CCNGG 1 cut(s) 132
BmsI GCATC 3 cut(s) 56, 71, 162
Bpu10I CCTNAGC 1 cut(s) 204
BpuMI CCSGG 1 cut(s) 132
Bse1I ACTGG 2 cut(s) 66, 85
BseGI GGATG 2 cut(s) 62, 127
BseMII CTCAG 1 cut(s) 195
BseNI ACTGG 2 cut(s) 66, 85
BseXI GCAGC 5 cut(s) 18, 19, 28, 56, 85
BshFI GGCC 1 cut(s) 162
BsiSI CCGG 1 cut(s) 132
BsnI GGCC 1 cut(s) 162
Bsp1286I GDGCHC 1 cut(s) 226
Bsp143I GATC 2 cut(s) 184, 247
BspACI CCGC 2 cut(s) 84, 335
BspANI GGCC 1 cut(s) 162
BspCNI CTCAG 1 cut(s) 196
BspLI GGNNCC 1 cut(s) 18
BspMAI CTGCAG 1 cut(s) 46
BspPI GGATC 1 cut(s) 179
BsrI ACTGG 2 cut(s) 66, 85
BssMI GATC 2 cut(s) 184, 247
BssSI CACGAG 1 cut(s) 189
Bst2BI CACGAG 1 cut(s) 189
BstDEI CTNAG 1 cut(s) 204
BstF5I GGATG 2 cut(s) 62, 127
BstKTI GATC 2 cut(s) 187, 250
BstMBI GATC 2 cut(s) 184, 247
BstMWI GCNNNNNNNGC 5 cut(s) 38, 41, 90, 104, 159
BstSCI CCNGG 1 cut(s) 130
BstSFI CTRYAG 1 cut(s) 42
BstV1I GCAGC 5 cut(s) 18, 19, 28, 56, 85
BsuRI GGCC 1 cut(s) 162
BtsCI GGATG 2 cut(s) 62, 127
BtsIMutI CAGTG 1 cut(s) 78
Cfr13I GGNCC 1 cut(s) 357
CviAII CATG 4 cut(s) 182, 227, 237, 251
CviJI RGCY 8 cut(s) 17, 93, 123, 162, 172, 224, 284, 295
CviKI_1 RGCY 8 cut(s) 17, 93, 123, 162, 172, 224, 284, 295
DdeI CTNAG 1 cut(s) 204
DpnI GATC 2 cut(s) 186, 249
DpnII GATC 2 cut(s) 184, 247
DrdI GACNNNNNNGTC 1 cut(s) 173
DseDI GACNNNNNNGTC 1 cut(s) 173
Eco24I GRGCYC 1 cut(s) 226
Eco47I GGWCC 1 cut(s) 357
EcoT22I ATGCAT 1 cut(s) 64
EcoT38I GRGCYC 1 cut(s) 226
FaeI CATG 4 cut(s) 185, 230, 240, 254
FaiI YATR 6 cut(s) 183, 219, 228, 238, 252, 328
FalI AAGNNNNNCTT 2 cut(s) 272, 304
FatI CATG 4 cut(s) 181, 226, 236, 250
FbaI TGATCA 1 cut(s) 247
Fnu4HI GCNGC 5 cut(s) 7, 33, 42, 45, 99
FokI GGATG 2 cut(s) 49, 114
FriOI GRGCYC 1 cut(s) 226
Fsp4HI GCNGC 5 cut(s) 7, 33, 42, 45, 99
GluI GCNGC 5 cut(s) 7, 33, 42, 45, 99
HaeIII GGCC 1 cut(s) 162
HapII CCGG 1 cut(s) 132
Hin1II CATG 4 cut(s) 185, 230, 240, 254
HinfI GANTC 3 cut(s) 22, 140, 318
HpaII CCGG 1 cut(s) 132
Hpy188I TCNGA 1 cut(s) 21
Hpy188III TCNNGA 1 cut(s) 363
HpyAV CCTTC 1 cut(s) 134
HpyCH4IV ACGT 1 cut(s) 117
HpyCH4V TGCA 2 cut(s) 44, 62
HpyF10VI GCNNNNNNNGC 5 cut(s) 38, 41, 90, 104, 159
HpyF3I CTNAG 1 cut(s) 204
HpySE526I ACGT 1 cut(s) 117
Hsp92II CATG 4 cut(s) 185, 230, 240, 254
Ksp22I TGATCA 1 cut(s) 247
Kzo9I GATC 2 cut(s) 184, 247
LmnI GCTCC 1 cut(s) 22
LpnPI CCDG 4 cut(s) 66, 79, 145, 157
Lsp1109I GCAGC 5 cut(s) 18, 19, 28, 56, 85
LweI GCATC 3 cut(s) 56, 71, 162
MaeII ACGT 1 cut(s) 117
MaeIII GTNAC 1 cut(s) 229
MalI GATC 2 cut(s) 186, 249
MboI GATC 2 cut(s) 184, 247
MboII GAAGA 1 cut(s) 253
MhlI GDGCHC 1 cut(s) 226
MluCI AATT 2 cut(s) 260, 306
MnlI CCTC 5 cut(s) 185, 188, 199, 250, 306
Mph1103I ATGCAT 1 cut(s) 64
MseI TTAA 1 cut(s) 291
MspI CCGG 1 cut(s) 132
MspR9I CCNGG 1 cut(s) 132
MwoI GCNNNNNNNGC 5 cut(s) 38, 41, 90, 104, 159
NciI CCSGG 1 cut(s) 132
NdeII GATC 2 cut(s) 184, 247
NlaIII CATG 4 cut(s) 185, 230, 240, 254
NlaIV GGNNCC 1 cut(s) 18
NsiI ATGCAT 1 cut(s) 64
PfeI GAWTC 3 cut(s) 22, 140, 318
PkrI GCNGC 5 cut(s) 8, 34, 43, 46, 100
PspN4I GGNNCC 1 cut(s) 18
PspPI GGNCC 1 cut(s) 357
PstI CTGCAG 1 cut(s) 46
SaqAI TTAA 1 cut(s) 291
SatI GCNGC 5 cut(s) 7, 33, 42, 45, 99
Sau3AI GATC 2 cut(s) 184, 247
Sau96I GGNCC 1 cut(s) 357
ScrFI CCNGG 1 cut(s) 132
SduI GDGCHC 1 cut(s) 226
SetI ASST 3 cut(s) 120, 174, 210
SfaNI GCATC 3 cut(s) 56, 71, 162
SfcI CTRYAG 1 cut(s) 42
SinI GGWCC 1 cut(s) 357
Sse9I AATT 2 cut(s) 260, 306
SsiI CCGC 2 cut(s) 84, 335
StyD4I CCNGG 1 cut(s) 130
TaiI ACGT 1 cut(s) 120
TasI AATT 2 cut(s) 260, 306
TfiI GAWTC 3 cut(s) 22, 140, 318
Tru1I TTAA 1 cut(s) 291
Tru9I TTAA 1 cut(s) 291
TscAI CASTG 1 cut(s) 85
TseI GCWGC 5 cut(s) 6, 32, 41, 44, 98
TspDTI ATGAA 2 cut(s) 116, 225
TspRI CASTG 1 cut(s) 85
VpaK11BI GGWCC 1 cut(s) 357
Zsp2I ATGCAT 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.