RchiOBHm_Chr4g0394931

Mycolic acid cyclopropane synthetase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
10722316 .. 10723034
719 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36740

Sequence Viewer

Length: 447 bp
ATGTATTCTACTTTCTCAACTTCGATCCTGCATTGCCTGTGCCACTTGTTTTATCTTCTTCTGTCTTCTATCTTACTAGAAGAGGGAGGCACAATGTTCACCTTTGAGGGAAGCAAAAAGGACTGTTCTCTAAAATCCGTTCTTATAGTTCATAGTCCTCAGTTTTATTGGAAAGTAATGACACAGGCTGATCTAGGCATTACAGATGCATATATCAATTGCGATTTTTCTTTCCATGATAAAGACCGAGGTCTTCTAAATCTTCTTATGGTAAGACAATTGAACATTAATTGCAATCTCATTCTCCTTATTATGCAGATTTTGATAAAATTTTGCCTTGCTGTTTCTTCTTCCAGTTTCTCATTGCCAACGAAGATTCTAATGCCTCAAAATCAAACAAGAAAAGGTGCAATGCACCGATTATCTCAAACTAGAATTGTGATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

148

Amino Acids

16.87

Weight (kDa)

8.8

Isoelectric Point (pI)

45.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000555)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 19
AcsI RAATTY 1 cut(s) 329
AgsI TTSAA 1 cut(s) 283
AlwI GGATC 1 cut(s) 19
ApoI RAATTY 1 cut(s) 329
AseI ATTAAT 1 cut(s) 288
AsuHPI GGTGA 1 cut(s) 91
BbsI GAAGAC 2 cut(s) 57, 245
BfaI CTAG 3 cut(s) 77, 194, 432
BmsI GCATC 1 cut(s) 196
BoxI GACNNNNGTC 1 cut(s) 249
BpiI GAAGAC 2 cut(s) 57, 245
BsaJI CCNNGG 1 cut(s) 247
Bse1I ACTGG 1 cut(s) 354
Bse3DI GCAATG 3 cut(s) 31, 362, 417
BseDI CCNNGG 1 cut(s) 247
BseMI GCAATG 3 cut(s) 31, 362, 417
BseMII CTCAG 1 cut(s) 173
BseNI ACTGG 1 cut(s) 354
Bsp143I GATC 2 cut(s) 24, 190
BspCNI CTCAG 1 cut(s) 172
BspPI GGATC 1 cut(s) 19
BsrDI GCAATG 3 cut(s) 31, 362, 417
BsrI ACTGG 1 cut(s) 354
BssECI CCNNGG 1 cut(s) 247
BssMI GATC 2 cut(s) 24, 190
Bst4CI ACNGT 1 cut(s) 125
Bst6I CTCTTC 1 cut(s) 75
BstDEI CTNAG 1 cut(s) 159
BstKTI GATC 2 cut(s) 27, 193
BstMBI GATC 2 cut(s) 24, 190
BstPAI GACNNNNGTC 1 cut(s) 249
BstV2I GAAGAC 2 cut(s) 57, 245
CviAII CATG 1 cut(s) 236
CviJI RGCY 1 cut(s) 188
CviKI_1 RGCY 1 cut(s) 188
DdeI CTNAG 1 cut(s) 159
DpnI GATC 2 cut(s) 26, 192
DpnII GATC 2 cut(s) 24, 190
Eam1104I CTCTTC 1 cut(s) 75
EarI CTCTTC 1 cut(s) 75
EcoT22I ATGCAT 1 cut(s) 211
FaeI CATG 1 cut(s) 239
FaiI YATR 8 cut(s) 146, 153, 211, 213, 237, 269, 314, 445
FatI CATG 1 cut(s) 235
FspBI CTAG 3 cut(s) 77, 194, 432
Hin1II CATG 1 cut(s) 239
HinfI GANTC 1 cut(s) 376
HphI GGTGA 1 cut(s) 91
Hpy166II GTNNAC 1 cut(s) 99
Hpy8I GTNNAC 1 cut(s) 99
HpyCH4III ACNGT 1 cut(s) 125
HpyCH4V TGCA 6 cut(s) 31, 209, 294, 316, 410, 415
HpyF3I CTNAG 1 cut(s) 159
Hsp92II CATG 1 cut(s) 239
Kzo9I GATC 2 cut(s) 24, 190
LpnPI CCDG 4 cut(s) 41, 50, 170, 367
LweI GCATC 1 cut(s) 196
MaeI CTAG 3 cut(s) 77, 194, 432
MalI GATC 2 cut(s) 26, 192
MboI GATC 2 cut(s) 24, 190
MboII GAAGA 9 cut(s) 47, 50, 57, 92, 245, 254, 339, 342, 385
MfeI CAATTG 2 cut(s) 217, 278
MluCI AATT 5 cut(s) 217, 278, 289, 329, 435
MnlI CCTC 6 cut(s) 76, 80, 100, 168, 242, 396
Mph1103I ATGCAT 1 cut(s) 211
MseI TTAA 1 cut(s) 288
MunI CAATTG 2 cut(s) 217, 278
NdeII GATC 2 cut(s) 24, 190
NlaIII CATG 1 cut(s) 239
NsiI ATGCAT 1 cut(s) 211
PfeI GAWTC 1 cut(s) 376
PshAI GACNNNNGTC 1 cut(s) 249
PshBI ATTAAT 1 cut(s) 288
SaqAI TTAA 1 cut(s) 288
Sau3AI GATC 2 cut(s) 24, 190
SetI ASST 3 cut(s) 104, 253, 409
SfaNI GCATC 1 cut(s) 196
Sse9I AATT 5 cut(s) 217, 278, 289, 329, 435
SspMI CTAG 3 cut(s) 77, 194, 432
TaaI ACNGT 1 cut(s) 125
TaqI TCGA 1 cut(s) 23
TaqII GACCGA 1 cut(s) 261
TasI AATT 5 cut(s) 217, 278, 289, 329, 435
TfiI GAWTC 1 cut(s) 376
Tru1I TTAA 1 cut(s) 288
Tru9I TTAA 1 cut(s) 288
TspDTI ATGAA 1 cut(s) 140
TspGWI ACGGA 1 cut(s) 127
VspI ATTAAT 1 cut(s) 288
XapI RAATTY 1 cut(s) 329
XspI CTAG 3 cut(s) 77, 194, 432
Zsp2I ATGCAT 1 cut(s) 211
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.