Rh1DG071500

Mycolic acid cyclopropane synthetase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
12911326 .. 12912141
816 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG071500.1

Sequence Viewer

Length: 318 bp
ATGGCTCTTTCATTGACGGAAACAACAACACGCCTATTTGTTACTAGATTTCTTAGACAATATATATCTACTGGATGTTTAATCTTATTAGAAGAGGGAGGCACAATATTCAACTTTGAGGGAAGCAAAAAGGACTGTTCTCTAAAATCCGTTCTCAAAGTTCATAGTCCTCAGTTTTACTGGAAAGTAATGACACAGGCTGATCTAGGCATTGCAGATGCATATATCAGTGGAGATTTTTCTTTTGATGATAAAGACCGAGGTCTTCTAAATCTTTTTATGCTTCTTCTTGCCAACGGAGATTCTAATCACTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

11.85

Weight (kDa)

5.54

Isoelectric Point (pI)

23.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000555)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 112
BbsI GAAGAC 1 cut(s) 257
BfaI CTAG 3 cut(s) 45, 206, 316
BmsI GCATC 1 cut(s) 208
BoxI GACNNNNGTC 1 cut(s) 261
BpiI GAAGAC 1 cut(s) 257
BsaBI GATNNNNATC 1 cut(s) 306
BsaJI CCNNGG 1 cut(s) 259
Bse1I ACTGG 2 cut(s) 76, 185
Bse3DI GCAATG 1 cut(s) 210
Bse8I GATNNNNATC 1 cut(s) 306
BseDI CCNNGG 1 cut(s) 259
BseGI GGATG 1 cut(s) 80
BseJI GATNNNNATC 1 cut(s) 306
BseMI GCAATG 1 cut(s) 210
BseMII CTCAG 1 cut(s) 185
BseNI ACTGG 2 cut(s) 76, 185
Bsp143I GATC 1 cut(s) 202
BspCNI CTCAG 1 cut(s) 184
BsrDI GCAATG 1 cut(s) 210
BsrI ACTGG 2 cut(s) 76, 185
BssECI CCNNGG 1 cut(s) 259
BssMI GATC 1 cut(s) 202
Bst4CI ACNGT 1 cut(s) 137
Bst6I CTCTTC 1 cut(s) 87
BstDEI CTNAG 2 cut(s) 53, 171
BstF5I GGATG 1 cut(s) 80
BstKTI GATC 1 cut(s) 205
BstMBI GATC 1 cut(s) 202
BstPAI GACNNNNGTC 1 cut(s) 261
BstV2I GAAGAC 1 cut(s) 257
BtsCI GGATG 1 cut(s) 80
BtsIMutI CAGTG 1 cut(s) 235
CviJI RGCY 2 cut(s) 5, 200
CviKI_1 RGCY 2 cut(s) 5, 200
DdeI CTNAG 2 cut(s) 53, 171
DpnI GATC 1 cut(s) 204
DpnII GATC 1 cut(s) 202
Eam1104I CTCTTC 1 cut(s) 87
EarI CTCTTC 1 cut(s) 87
EcoT22I ATGCAT 1 cut(s) 223
FaiI YATR 6 cut(s) 63, 65, 165, 223, 225, 281
FokI GGATG 1 cut(s) 87
FspBI CTAG 3 cut(s) 45, 206, 316
HinfI GANTC 1 cut(s) 302
HpyCH4III ACNGT 1 cut(s) 137
HpyCH4V TGCA 2 cut(s) 215, 221
HpyF3I CTNAG 2 cut(s) 53, 171
Kzo9I GATC 1 cut(s) 202
LpnPI CCDG 3 cut(s) 57, 166, 182
LweI GCATC 1 cut(s) 208
MaeI CTAG 3 cut(s) 45, 206, 316
MaeIII GTNAC 1 cut(s) 40
MalI GATC 1 cut(s) 204
MboI GATC 1 cut(s) 202
MboII GAAGA 3 cut(s) 104, 257, 278
MnlI CCTC 5 cut(s) 88, 92, 112, 180, 254
Mph1103I ATGCAT 1 cut(s) 223
MseI TTAA 1 cut(s) 80
NdeII GATC 1 cut(s) 202
NsiI ATGCAT 1 cut(s) 223
PfeI GAWTC 1 cut(s) 302
PshAI GACNNNNGTC 1 cut(s) 261
SaqAI TTAA 1 cut(s) 80
Sau3AI GATC 1 cut(s) 202
SetI ASST 1 cut(s) 265
SfaNI GCATC 1 cut(s) 208
SgeI CNNG 8 cut(s) 42, 57, 84, 193, 209, 218, 272, 302
SspI AATATT 1 cut(s) 108
SspMI CTAG 3 cut(s) 45, 206, 316
TaaI ACNGT 1 cut(s) 137
TaqII GACCGA 1 cut(s) 273
TfiI GAWTC 1 cut(s) 302
Tru1I TTAA 1 cut(s) 80
Tru9I TTAA 1 cut(s) 80
TscAI CASTG 1 cut(s) 235
TspDTI ATGAA 1 cut(s) 152
TspGWI ACGGA 3 cut(s) 32, 139, 312
TspRI CASTG 1 cut(s) 235
XspI CTAG 3 cut(s) 45, 206, 316
Zsp2I ATGCAT 1 cut(s) 223
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.