RchiOBHm_Chr5g0052451

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0001336
Physical Location & Seq
Forward (+)
54330377 .. 54332766
2390 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32985

Sequence Viewer

Length: 216 bp
ATGAAACCCGTCTTGAGAGATGATGCCGCAACAATCTCTCTCCCTCTCATCACATACAATGCATCAATCTCTGATCACAGACGCCCCATCAACCTCTCTCCCTCTGACACAGCCTCATCTAGCCTTTCATCACGATTTTGGGTTGGAAATCGAAGCCTCACTCAAGCAAGGCTGCTTGGCGATTTGATTCAGTTCTTGGAACTGGAATACCAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

7.95

Weight (kDa)

6.53

Isoelectric Point (pI)

45.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 27
AcyI GRCGYC 1 cut(s) 82
ApeKI GCWGC 1 cut(s) 172
BbvI GCAGC 1 cut(s) 159
BccI CCATC 1 cut(s) 95
BclI TGATCA 1 cut(s) 73
BfaI CTAG 1 cut(s) 120
BisI GCNGC 2 cut(s) 27, 173
BlsI GCNGC 2 cut(s) 28, 174
BmsI GCATC 2 cut(s) 13, 71
BpuEI CTTGAG 2 cut(s) 34, 147
BsaHI GRCGYC 1 cut(s) 82
Bse1I ACTGG 1 cut(s) 207
BseNI ACTGG 1 cut(s) 207
BseXI GCAGC 1 cut(s) 159
Bsp143I GATC 1 cut(s) 73
BspACI CCGC 1 cut(s) 27
BsrI ACTGG 1 cut(s) 207
BssMI GATC 1 cut(s) 73
BssNI GRCGYC 1 cut(s) 82
BstACI GRCGYC 1 cut(s) 82
BstKTI GATC 1 cut(s) 76
BstMBI GATC 1 cut(s) 73
BstV1I GCAGC 1 cut(s) 159
CseI GACGC 1 cut(s) 90
CviJI RGCY 4 cut(s) 113, 123, 156, 172
CviKI_1 RGCY 4 cut(s) 113, 123, 156, 172
DpnI GATC 1 cut(s) 75
DpnII GATC 1 cut(s) 73
EcoT22I ATGCAT 1 cut(s) 64
FaiI YATR 1 cut(s) 55
FbaI TGATCA 1 cut(s) 73
Fnu4HI GCNGC 2 cut(s) 27, 173
Fsp4HI GCNGC 2 cut(s) 27, 173
FspBI CTAG 1 cut(s) 120
GluI GCNGC 2 cut(s) 27, 173
HgaI GACGC 1 cut(s) 90
Hin1I GRCGYC 1 cut(s) 82
HinfI GANTC 1 cut(s) 187
Hpy188I TCNGA 2 cut(s) 73, 106
Hpy188III TCNNGA 2 cut(s) 13, 132
HpyCH4V TGCA 1 cut(s) 62
Hsp92I GRCGYC 1 cut(s) 82
Ksp22I TGATCA 1 cut(s) 73
Kzo9I GATC 1 cut(s) 73
LpnPI CCDG 1 cut(s) 188
Lsp1109I GCAGC 1 cut(s) 159
LweI GCATC 2 cut(s) 13, 71
MaeI CTAG 1 cut(s) 120
MalI GATC 1 cut(s) 75
MboI GATC 1 cut(s) 73
MmeI TCCRAC 1 cut(s) 124
MnlI CCTC 5 cut(s) 54, 104, 112, 124, 167
Mph1103I ATGCAT 1 cut(s) 64
NdeII GATC 1 cut(s) 73
NsiI ATGCAT 1 cut(s) 64
PfeI GAWTC 1 cut(s) 187
PkrI GCNGC 2 cut(s) 28, 174
SatI GCNGC 2 cut(s) 27, 173
Sau3AI GATC 1 cut(s) 73
SetI ASST 1 cut(s) 96
SfaNI GCATC 2 cut(s) 13, 71
SgeI CNNG 8 cut(s) 20, 25, 132, 144, 176, 180, 188, 208
SmlI CTYRAG 2 cut(s) 13, 162
SmoI CTYRAG 2 cut(s) 13, 162
SsiI CCGC 1 cut(s) 27
SspMI CTAG 1 cut(s) 120
TaqI TCGA 1 cut(s) 151
TauI GCSGC 1 cut(s) 29
TfiI GAWTC 1 cut(s) 187
TseI GCWGC 1 cut(s) 172
TspDTI ATGAA 2 cut(s) 17, 117
XspI CTAG 1 cut(s) 120
Zsp2I ATGCAT 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.