Rmu_co8336117.1_g000001

Zinc finger BED domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8336117.1
Physical Location & Seq
Forward (+)
35 .. 945
911 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8336117.1_g000001.1.cds

Sequence Viewer

Length: 786 bp
atggcttctacaagtaggtcaggaagtcgttgttgttcatccccgtccataacatccaacatggttagtgaaagtgctcaaccaacaatggtttccccaaatactaacctaaaccctataccagtattagaaaacattaccccggactcagttcctgttccaaccccaaatactacaccaaatttagatcctacctcagtggaagacactgcggggctggggaaaaggaaaacacaagaaaagaccacaaagggtaggaaaaagagtcaagtctgggattgtttcactaggcctttgctccctgatggcaaggctgacccagataatgcccaatgcaactattgtaaggcaatagttcctgcatctagttccaaaaatggaaccagttcttgctggtcccatgctagaaactgcaaggttaatcctctttttgagaaaccaatcgacaaagggcagactatcttatgtagggataatataactggggctccacaatatcacagattcaatcagggtaggatagatcagaagttgtacaaaatgatcataagggatgaacttccctttaggcatgtagagggttttgggtttagggaatttatggaagaagctcagccacaatggattcaaccaagtaggaagttagtggccaagggagtgtgggaattgtacaaatctgaaaagaccaagatgatgtcgatctttgcacaccatgcaaaaagatcacaaaggggaagatatagggaggattctggagcagtgtttgagggaatgggatatcaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

261

Amino Acids

29.25

Weight (kDa)

9.33

Isoelectric Point (pI)

46.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 212
AclWI GGATC 1 cut(s) 182
AcoI YGGCCR 1 cut(s) 648
AcsI RAATTY 2 cut(s) 181, 596
AfaI GTAC 2 cut(s) 536, 671
AgsI TTSAA 2 cut(s) 508, 629
AjuI GAANNNNNNNTTGG 2 cut(s) 76, 108
AluBI AGCT 1 cut(s) 611
AluI AGCT 1 cut(s) 611
Alw21I GWGCWC 1 cut(s) 79
AlwI GGATC 1 cut(s) 182
AlwNI CAGNNNCTG 1 cut(s) 155
AoxI GGCC 2 cut(s) 290, 648
ApoI RAATTY 2 cut(s) 181, 596
Asp700I GAANNNNTTC 1 cut(s) 385
AspS9I GGNCC 1 cut(s) 396
AsuC2I CCSGG 1 cut(s) 143
AvaII GGWCC 1 cut(s) 396
BalI TGGCCA 1 cut(s) 650
BanII GRGCYC 1 cut(s) 490
BbsI GAAGAC 1 cut(s) 210
Bbv12I GWGCWC 1 cut(s) 79
BccI CCATC 1 cut(s) 299
BclI TGATCA 1 cut(s) 543
BcnI CCSGG 1 cut(s) 143
BfaI CTAG 3 cut(s) 288, 366, 405
BlpI GCTNAGC 1 cut(s) 612
Bme1390I CCNGG 1 cut(s) 143
Bme18I GGWCC 1 cut(s) 396
BmgT120I GGNCC 1 cut(s) 396
BmiI GGNNCC 3 cut(s) 382, 398, 489
BmrFI CCNGG 1 cut(s) 143
BmrI ACTGGG 1 cut(s) 492
BmsI GCATC 1 cut(s) 371
BmuI ACTGGG 1 cut(s) 492
BpiI GAAGAC 1 cut(s) 210
BpmI CTGGAG 1 cut(s) 774
Bpu1102I GCTNAGC 1 cut(s) 612
BpuMI CCSGG 1 cut(s) 143
BsaBI GATNNNNATC 1 cut(s) 698
BsaJI CCNNGG 2 cut(s) 141, 651
BsaXI ACNNNNNCTCC 2 cut(s) 472, 502
Bse1I ACTGG 3 cut(s) 122, 384, 487
Bse8I GATNNNNATC 1 cut(s) 698
BseDI CCNNGG 2 cut(s) 141, 651
BseGI GGATG 3 cut(s) 38, 53, 559
BseJI GATNNNNATC 1 cut(s) 698
BseMII CTCAG 3 cut(s) 162, 210, 626
BseNI ACTGG 3 cut(s) 122, 384, 487
BseYI CCCAGC 1 cut(s) 217
BshFI GGCC 2 cut(s) 292, 650
BsiHKAI GWGCWC 1 cut(s) 79
BsiSI CCGG 1 cut(s) 143
BslFI GGGAC 1 cut(s) 382
BsmFI GGGAC 1 cut(s) 382
BsnI GGCC 2 cut(s) 292, 650
Bsp1286I GDGCHC 2 cut(s) 79, 490
Bsp1407I TGTACA 2 cut(s) 534, 669
Bsp143I GATC 5 cut(s) 187, 523, 543, 699, 722
Bsp1720I GCTNAGC 1 cut(s) 612
BspACI CCGC 1 cut(s) 212
BspANI GGCC 2 cut(s) 292, 650
BspCNI CTCAG 3 cut(s) 161, 209, 625
BspLI GGNNCC 3 cut(s) 382, 398, 489
BspPI GGATC 1 cut(s) 182
BsrGI TGTACA 2 cut(s) 534, 669
BsrI ACTGG 3 cut(s) 122, 384, 487
BssECI CCNNGG 2 cut(s) 141, 651
BssMI GATC 5 cut(s) 187, 523, 543, 699, 722
BssT1I CCWWGG 1 cut(s) 651
BstAPI GCANNNNNTGC 1 cut(s) 713
BstAUI TGTACA 2 cut(s) 534, 669
BstDEI CTNAG 3 cut(s) 148, 196, 612
BstF5I GGATG 3 cut(s) 38, 53, 559
BstKTI GATC 5 cut(s) 190, 526, 546, 702, 725
BstMBI GATC 5 cut(s) 187, 523, 543, 699, 722
BstMWI GCNNNNNNNGC 1 cut(s) 713
BstNSI RCATGY 1 cut(s) 575
BstSCI CCNGG 1 cut(s) 141
BstV2I GAAGAC 1 cut(s) 210
BstX2I RGATCY 1 cut(s) 187
BstYI RGATCY 1 cut(s) 187
BsuRI GGCC 2 cut(s) 292, 650
BtsCI GGATG 3 cut(s) 38, 53, 559
BtsI GCAGTG 2 cut(s) 207, 765
BtsIMutI CAGTG 3 cut(s) 204, 207, 765
CaiI CAGNNNCTG 1 cut(s) 155
Cfr13I GGNCC 1 cut(s) 396
Csp6I GTAC 2 cut(s) 535, 670
CviAII CATG 4 cut(s) 61, 401, 572, 713
CviJI RGCY 8 cut(s) 5, 217, 292, 314, 488, 611, 616, 650
CviKI_1 RGCY 8 cut(s) 5, 217, 292, 314, 488, 611, 616, 650
CviQI GTAC 2 cut(s) 535, 670
DdeI CTNAG 3 cut(s) 148, 196, 612
DpnI GATC 5 cut(s) 189, 525, 545, 701, 724
DpnII GATC 5 cut(s) 187, 523, 543, 699, 722
EaeI YGGCCR 1 cut(s) 648
Eco130I CCWWGG 1 cut(s) 651
Eco147I AGGCCT 1 cut(s) 292
Eco24I GRGCYC 1 cut(s) 490
Eco32I GATATC 1 cut(s) 779
Eco47I GGWCC 1 cut(s) 396
EcoRV GATATC 1 cut(s) 779
EcoT14I CCWWGG 1 cut(s) 651
EcoT38I GRGCYC 1 cut(s) 490
ErhI CCWWGG 1 cut(s) 651
FaeI CATG 4 cut(s) 64, 404, 575, 716
FaqI GGGAC 1 cut(s) 382
FatI CATG 4 cut(s) 60, 400, 571, 712
FauI CCCGC 1 cut(s) 205
FbaI TGATCA 1 cut(s) 543
FokI GGATG 3 cut(s) 25, 40, 566
FriOI GRGCYC 1 cut(s) 490
FspBI CTAG 3 cut(s) 288, 366, 405
GsaI CCCAGC 1 cut(s) 221
GsuI CTGGAG 1 cut(s) 774
HaeIII GGCC 2 cut(s) 292, 650
HapII CCGG 1 cut(s) 143
Hin1II CATG 4 cut(s) 64, 404, 575, 716
HinfI GANTC 5 cut(s) 146, 265, 504, 625, 749
HpaII CCGG 1 cut(s) 143
Hpy188I TCNGA 2 cut(s) 528, 679
Hpy188III TCNNGA 2 cut(s) 21, 753
HpyCH4V TGCA 5 cut(s) 336, 362, 414, 707, 716
HpyF10VI GCNNNNNNNGC 1 cut(s) 713
HpyF3I CTNAG 3 cut(s) 148, 196, 612
Hsp92II CATG 4 cut(s) 64, 404, 575, 716
Ksp22I TGATCA 1 cut(s) 543
Kzo9I GATC 5 cut(s) 187, 523, 543, 699, 722
LmnI GCTCC 3 cut(s) 303, 493, 755
LweI GCATC 1 cut(s) 371
MaeI CTAG 3 cut(s) 288, 366, 405
MalI GATC 5 cut(s) 189, 525, 545, 701, 724
MboI GATC 5 cut(s) 187, 523, 543, 699, 722
MboII GAAGA 3 cut(s) 215, 617, 747
MflI RGATCY 1 cut(s) 187
MhlI GDGCHC 2 cut(s) 79, 490
MlsI TGGCCA 1 cut(s) 650
MluCI AATT 3 cut(s) 181, 596, 665
MluNI TGGCCA 1 cut(s) 650
MlyI GAGTC 2 cut(s) 140, 274
MmeI TCCRAC 2 cut(s) 81, 185
MnlI CCTC 5 cut(s) 205, 435, 571, 739, 760
Mox20I TGGCCA 1 cut(s) 650
MroXI GAANNNNTTC 1 cut(s) 385
MscI TGGCCA 1 cut(s) 650
MseI TTAA 1 cut(s) 420
Msp20I TGGCCA 1 cut(s) 650
MspI CCGG 1 cut(s) 143
MspR9I CCNGG 1 cut(s) 143
MwoI GCNNNNNNNGC 1 cut(s) 713
NciI CCSGG 1 cut(s) 143
NdeII GATC 5 cut(s) 187, 523, 543, 699, 722
NlaIII CATG 4 cut(s) 64, 404, 575, 716
NlaIV GGNNCC 3 cut(s) 382, 398, 489
NspI RCATGY 1 cut(s) 575
PceI AGGCCT 1 cut(s) 292
PdmI GAANNNNTTC 1 cut(s) 385
PfeI GAWTC 3 cut(s) 504, 625, 749
PleI GAGTC 2 cut(s) 140, 273
PpsI GAGTC 2 cut(s) 140, 273
PspFI CCCAGC 1 cut(s) 217
PspN4I GGNNCC 3 cut(s) 382, 398, 489
PspPI GGNCC 1 cut(s) 396
PstNI CAGNNNCTG 1 cut(s) 155
PsuI RGATCY 1 cut(s) 187
RsaI GTAC 2 cut(s) 536, 671
RsaNI GTAC 2 cut(s) 535, 670
SaqAI TTAA 1 cut(s) 420
Sau3AI GATC 5 cut(s) 187, 523, 543, 699, 722
Sau96I GGNCC 1 cut(s) 396
SchI GAGTC 2 cut(s) 140, 274
ScrFI CCNGG 1 cut(s) 143
SduI GDGCHC 2 cut(s) 79, 490
SetI ASST 5 cut(s) 20, 111, 197, 420, 613
SfaNI GCATC 1 cut(s) 371
SinI GGWCC 1 cut(s) 396
Sse9I AATT 3 cut(s) 181, 596, 665
SseBI AGGCCT 1 cut(s) 292
SsiI CCGC 1 cut(s) 212
SspMI CTAG 3 cut(s) 288, 366, 405
StuI AGGCCT 1 cut(s) 292
StyD4I CCNGG 1 cut(s) 141
StyI CCWWGG 1 cut(s) 651
TaqI TCGA 2 cut(s) 444, 698
TasI AATT 3 cut(s) 181, 596, 665
TatI WGTACW 2 cut(s) 534, 669
TfiI GAWTC 3 cut(s) 504, 625, 749
Tru1I TTAA 1 cut(s) 420
Tru9I TTAA 1 cut(s) 420
TscAI CASTG 3 cut(s) 204, 214, 765
TspDTI ATGAA 2 cut(s) 27, 570
TspRI CASTG 3 cut(s) 204, 214, 765
VpaK11BI GGWCC 1 cut(s) 396
XapI RAATTY 2 cut(s) 181, 596
XceI RCATGY 1 cut(s) 575
XmnI GAANNNNTTC 1 cut(s) 385
XspI CTAG 3 cut(s) 288, 366, 405
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.