Rmu_sc0013184.1_g000003

Zinc finger BED domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013184.1
OG0001336
Physical Location & Seq
Reverse (-)
1423 .. 2151
729 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013184.1_g000003.1.cds

Sequence Viewer

Length: 729 bp
atggttactggaagttatcaatctgttagtgtttccccaaatgataaccaaaaccctttaccaccagtaggtaacttaccaccaatagataatagtaccccaactgaaacacctaacttagttcccactacaaccccaactgaaacaccaaatccagatcctgaattggtggaagctactgcggggttggggaaaagaaaaggagtagataagaccacaaagggtaggaaacagagtcgagtatgggagtgttttacaaggcctttgctccctgatggcaagcctgaccctagtaatgcacaatgcaactactgtaaagcattagttcctgcgttaagttcaaagaatggaaccagttcttgctggtcacatggaagaaactgcaaggttaaccctctatttgagaaaccaatcgagaaagggcagaccatattatctagggataatgtttccggggctccacaatatcacagatttaatcagggtaggatagatgagaagctgtacaagatgatcataagggatgaacttccctttaggcatgtggagggttttggctttaaggaatttatgctagaagctcagccacagtggattcaaccaagtagaaagttagtggccaagggagtgtgggaattgtacctatctgagaagggaaagatgatgtcgatctttgcacagcatgcaaagagagttagtgtgaccactgacacttggacatcaatttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4413 Dimer_Tnp_hAT zf-BED

Protein Analysis

242

Amino Acids

27.0

Weight (kDa)

9.16

Isoelectric Point (pI)

40.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 182
AclWI GGATC 1 cut(s) 152
AcoI YGGCCR 1 cut(s) 618
AcsI RAATTY 1 cut(s) 566
AfaI GTAC 3 cut(s) 97, 506, 641
AfiI CCNNNNNNNGG 1 cut(s) 68
AgsI TTSAA 2 cut(s) 342, 599
AluBI AGCT 3 cut(s) 176, 502, 581
AluI AGCT 3 cut(s) 176, 502, 581
AlwI GGATC 1 cut(s) 152
AlwNI CAGNNNCTG 1 cut(s) 161
AoxI GGCC 2 cut(s) 260, 618
ApoI RAATTY 1 cut(s) 566
Asp700I GAANNNNTTC 1 cut(s) 355
AsuC2I CCSGG 1 cut(s) 454
BalI TGGCCA 1 cut(s) 620
BanII GRGCYC 1 cut(s) 460
BccI CCATC 1 cut(s) 269
BclI TGATCA 1 cut(s) 513
BcnI CCSGG 1 cut(s) 454
BfaI CTAG 3 cut(s) 291, 438, 575
BlpI GCTNAGC 1 cut(s) 582
Bme1390I CCNGG 1 cut(s) 454
BmiI GGNNCC 2 cut(s) 352, 459
BmrFI CCNGG 1 cut(s) 454
Bpu1102I GCTNAGC 1 cut(s) 582
BpuMI CCSGG 1 cut(s) 454
BsaBI GATNNNNATC 1 cut(s) 668
BsaJI CCNNGG 2 cut(s) 453, 621
Bsc4I CCNNNNNNNGG 1 cut(s) 68
Bse1I ACTGG 3 cut(s) 13, 65, 354
Bse8I GATNNNNATC 1 cut(s) 668
BseDI CCNNGG 2 cut(s) 453, 621
BseGI GGATG 1 cut(s) 529
BseJI GATNNNNATC 1 cut(s) 668
BseLI CCNNNNNNNGG 1 cut(s) 68
BseMII CTCAG 2 cut(s) 596, 639
BseNI ACTGG 3 cut(s) 13, 65, 354
BshFI GGCC 2 cut(s) 262, 620
BsiSI CCGG 1 cut(s) 453
BslI CCNNNNNNNGG 1 cut(s) 68
BsnI GGCC 2 cut(s) 262, 620
Bsp1286I GDGCHC 1 cut(s) 460
Bsp1407I TGTACA 1 cut(s) 504
Bsp143I GATC 3 cut(s) 157, 513, 669
Bsp1720I GCTNAGC 1 cut(s) 582
BspACI CCGC 1 cut(s) 182
BspANI GGCC 2 cut(s) 262, 620
BspCNI CTCAG 2 cut(s) 595, 640
BspLI GGNNCC 2 cut(s) 352, 459
BspPI GGATC 1 cut(s) 152
BsrGI TGTACA 1 cut(s) 504
BsrI ACTGG 3 cut(s) 13, 65, 354
BssECI CCNNGG 2 cut(s) 453, 621
BssMI GATC 3 cut(s) 157, 513, 669
BssT1I CCWWGG 1 cut(s) 621
Bst4CI ACNGT 2 cut(s) 314, 591
BstAPI GCANNNNNTGC 1 cut(s) 683
BstAUI TGTACA 1 cut(s) 504
BstC8I GCNNGC 2 cut(s) 281, 684
BstDEI CTNAG 3 cut(s) 118, 582, 648
BstF5I GGATG 1 cut(s) 529
BstKTI GATC 3 cut(s) 160, 516, 672
BstMBI GATC 3 cut(s) 157, 513, 669
BstMWI GCNNNNNNNGC 1 cut(s) 683
BstNSI RCATGY 2 cut(s) 545, 686
BstSCI CCNGG 1 cut(s) 452
BstX2I RGATCY 1 cut(s) 157
BstYI RGATCY 1 cut(s) 157
BsuRI GGCC 2 cut(s) 262, 620
BtsCI GGATG 1 cut(s) 529
BtsIMutI CAGTG 2 cut(s) 596, 705
Cac8I GCNNGC 2 cut(s) 281, 684
CaiI CAGNNNCTG 1 cut(s) 161
Csp6I GTAC 3 cut(s) 96, 505, 640
CviAII CATG 3 cut(s) 371, 542, 683
CviJI RGCY 9 cut(s) 176, 262, 283, 458, 502, 558, 581, 586, 620
CviKI_1 RGCY 9 cut(s) 176, 262, 283, 458, 502, 558, 581, 586, 620
CviQI GTAC 3 cut(s) 96, 505, 640
DdeI CTNAG 3 cut(s) 118, 582, 648
DpnI GATC 3 cut(s) 159, 515, 671
DpnII GATC 3 cut(s) 157, 513, 669
EaeI YGGCCR 1 cut(s) 618
Eco130I CCWWGG 1 cut(s) 621
Eco147I AGGCCT 1 cut(s) 262
Eco24I GRGCYC 1 cut(s) 460
EcoT14I CCWWGG 1 cut(s) 621
EcoT38I GRGCYC 1 cut(s) 460
ErhI CCWWGG 1 cut(s) 621
FaeI CATG 3 cut(s) 374, 545, 686
FaiI YATR 7 cut(s) 244, 372, 431, 518, 543, 572, 684
FatI CATG 3 cut(s) 370, 541, 682
FauI CCCGC 1 cut(s) 175
FbaI TGATCA 1 cut(s) 513
FokI GGATG 1 cut(s) 536
FriOI GRGCYC 1 cut(s) 460
FspBI CTAG 3 cut(s) 291, 438, 575
HaeIII GGCC 2 cut(s) 262, 620
HapII CCGG 1 cut(s) 453
Hin1II CATG 3 cut(s) 374, 545, 686
HincII GTYRAC 1 cut(s) 391
HindII GTYRAC 1 cut(s) 391
HinfI GANTC 2 cut(s) 235, 595
HpaI GTTAAC 1 cut(s) 391
HpaII CCGG 1 cut(s) 453
Hpy166II GTNNAC 1 cut(s) 391
Hpy188I TCNGA 1 cut(s) 649
Hpy188III TCNNGA 3 cut(s) 155, 161, 415
Hpy8I GTNNAC 1 cut(s) 391
HpyAV CCTTC 1 cut(s) 646
HpyCH4III ACNGT 2 cut(s) 314, 591
HpyCH4V TGCA 5 cut(s) 299, 306, 384, 677, 686
HpyF10VI GCNNNNNNNGC 1 cut(s) 683
HpyF3I CTNAG 3 cut(s) 118, 582, 648
Hsp92II CATG 3 cut(s) 374, 545, 686
Ksp22I TGATCA 1 cut(s) 513
KspAI GTTAAC 1 cut(s) 391
Kzo9I GATC 3 cut(s) 157, 513, 669
LmnI GCTCC 2 cut(s) 273, 463
MaeI CTAG 3 cut(s) 291, 438, 575
MaeIII GTNAC 4 cut(s) 4, 71, 366, 700
MalI GATC 3 cut(s) 159, 515, 671
MboI GATC 3 cut(s) 157, 513, 669
MboII GAAGA 1 cut(s) 387
MflI RGATCY 1 cut(s) 157
MhlI GDGCHC 1 cut(s) 460
MlsI TGGCCA 1 cut(s) 620
MluCI AATT 4 cut(s) 164, 566, 635, 723
MluNI TGGCCA 1 cut(s) 620
MlyI GAGTC 1 cut(s) 244
MnlI CCTC 2 cut(s) 405, 541
Mox20I TGGCCA 1 cut(s) 620
MroXI GAANNNNTTC 1 cut(s) 355
MscI TGGCCA 1 cut(s) 620
MseI TTAA 4 cut(s) 335, 390, 477, 561
Msp20I TGGCCA 1 cut(s) 620
MspI CCGG 1 cut(s) 453
MspR9I CCNGG 1 cut(s) 454
MwoI GCNNNNNNNGC 1 cut(s) 683
NciI CCSGG 1 cut(s) 454
NdeII GATC 3 cut(s) 157, 513, 669
NlaIII CATG 3 cut(s) 374, 545, 686
NlaIV GGNNCC 2 cut(s) 352, 459
NmuCI GTSAC 2 cut(s) 366, 700
NspI RCATGY 2 cut(s) 545, 686
PaeI GCATGC 1 cut(s) 686
PceI AGGCCT 1 cut(s) 262
PdmI GAANNNNTTC 1 cut(s) 355
PfeI GAWTC 1 cut(s) 595
PleI GAGTC 1 cut(s) 243
PpsI GAGTC 1 cut(s) 243
PspN4I GGNNCC 2 cut(s) 352, 459
PstNI CAGNNNCTG 1 cut(s) 161
PsuI RGATCY 1 cut(s) 157
RsaI GTAC 3 cut(s) 97, 506, 641
RsaNI GTAC 3 cut(s) 96, 505, 640
SaqAI TTAA 4 cut(s) 335, 390, 477, 561
Sau3AI GATC 3 cut(s) 157, 513, 669
SchI GAGTC 1 cut(s) 244
ScrFI CCNGG 1 cut(s) 454
SduI GDGCHC 1 cut(s) 460
SetI ASST 7 cut(s) 73, 115, 178, 390, 504, 583, 645
SphI GCATGC 1 cut(s) 686
Sse9I AATT 4 cut(s) 164, 566, 635, 723
SseBI AGGCCT 1 cut(s) 262
SsiI CCGC 1 cut(s) 182
SspMI CTAG 3 cut(s) 291, 438, 575
StuI AGGCCT 1 cut(s) 262
StyD4I CCNGG 1 cut(s) 452
StyI CCWWGG 1 cut(s) 621
TaaI ACNGT 2 cut(s) 314, 591
TaqI TCGA 3 cut(s) 238, 414, 668
TasI AATT 4 cut(s) 164, 566, 635, 723
TatI WGTACW 1 cut(s) 504
TfiI GAWTC 1 cut(s) 595
Tru1I TTAA 4 cut(s) 335, 390, 477, 561
Tru9I TTAA 4 cut(s) 335, 390, 477, 561
TscAI CASTG 2 cut(s) 596, 712
TseFI GTSAC 2 cut(s) 366, 700
Tsp45I GTSAC 2 cut(s) 366, 700
TspDTI ATGAA 1 cut(s) 540
TspRI CASTG 2 cut(s) 596, 712
XapI RAATTY 1 cut(s) 566
XceI RCATGY 2 cut(s) 545, 686
XmnI GAANNNNTTC 1 cut(s) 355
XspI CTAG 3 cut(s) 291, 438, 575
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.