Rroxscaffold_1G00055130

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0001336
Physical Location & Seq
Forward (+)
76575242 .. 76577272
2031 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00055130.1

Sequence Viewer

Length: 204 bp
ATGAAACTCTACTTGATAGATGATGCCGCATCAATCTCCTCCCTCTCATCACAGACGCTGCATCAACCCATCAATCTCTCTCCCTCTGAAACCTCCTCAGCTAGCCTTTCATCAGGATTTTGGGTTGGAAATCGAAGCCTCACTCAAGCAAGGCTGCTTGGCAATTTGATTCAGCCTATGCACTTCGAAAAGGCTGCAAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.21

Weight (kDa)

6.7

Isoelectric Point (pI)

47.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 27
AluBI AGCT 2 cut(s) 101, 201
AluI AGCT 2 cut(s) 101, 201
AlwNI CAGNNNCTG 1 cut(s) 58
ApeKI GCWGC 3 cut(s) 58, 154, 194
AsuII TTCGAA 1 cut(s) 186
AsuNHI GCTAGC 1 cut(s) 101
BbvCI CCTCAGC 1 cut(s) 97
BbvI GCAGC 3 cut(s) 45, 141, 181
BccI CCATC 1 cut(s) 77
BcgI CGANNNNNNTGC 1 cut(s) 176
BfaI CTAG 1 cut(s) 102
BisI GCNGC 4 cut(s) 27, 59, 155, 195
BlsI GCNGC 4 cut(s) 28, 60, 156, 196
BmsI GCATC 3 cut(s) 13, 38, 70
BmtI GCTAGC 1 cut(s) 105
Bpu10I CCTNAGC 1 cut(s) 97
Bpu14I TTCGAA 1 cut(s) 186
BpuEI CTTGAG 1 cut(s) 129
BseMII CTCAG 1 cut(s) 111
BseRI GAGGAG 2 cut(s) 28, 85
BseXI GCAGC 3 cut(s) 45, 141, 181
Bsp119I TTCGAA 1 cut(s) 186
BspACI CCGC 1 cut(s) 27
BspCNI CTCAG 1 cut(s) 110
BspOI GCTAGC 1 cut(s) 105
BspT104I TTCGAA 1 cut(s) 186
BstBI TTCGAA 1 cut(s) 186
BstC8I GCNNGC 2 cut(s) 103, 199
BstDEI CTNAG 1 cut(s) 97
BstV1I GCAGC 3 cut(s) 45, 141, 181
Cac8I GCNNGC 2 cut(s) 103, 199
CaiI CAGNNNCTG 1 cut(s) 58
CseI GACGC 1 cut(s) 64
CviJI RGCY 7 cut(s) 101, 105, 138, 154, 175, 194, 201
CviKI_1 RGCY 7 cut(s) 101, 105, 138, 154, 175, 194, 201
DdeI CTNAG 1 cut(s) 97
FaiI YATR 1 cut(s) 179
Fnu4HI GCNGC 4 cut(s) 27, 59, 155, 195
Fsp4HI GCNGC 4 cut(s) 27, 59, 155, 195
FspBI CTAG 1 cut(s) 102
GluI GCNGC 4 cut(s) 27, 59, 155, 195
HgaI GACGC 1 cut(s) 64
HinfI GANTC 1 cut(s) 169
Hpy188I TCNGA 1 cut(s) 88
Hpy188III TCNNGA 1 cut(s) 114
HpyCH4V TGCA 3 cut(s) 61, 181, 197
HpyF3I CTNAG 1 cut(s) 97
LpnPI CCDG 1 cut(s) 99
Lsp1109I GCAGC 3 cut(s) 45, 141, 181
LweI GCATC 3 cut(s) 13, 38, 70
MaeI CTAG 1 cut(s) 102
MluCI AATT 1 cut(s) 163
MmeI TCCRAC 1 cut(s) 106
MnlI CCTC 6 cut(s) 49, 53, 94, 103, 106, 149
NheI GCTAGC 1 cut(s) 101
NspV TTCGAA 1 cut(s) 186
PfeI GAWTC 1 cut(s) 169
PkrI GCNGC 4 cut(s) 28, 60, 156, 196
PstNI CAGNNNCTG 1 cut(s) 58
SatI GCNGC 4 cut(s) 27, 59, 155, 195
SetI ASST 3 cut(s) 95, 103, 203
SfaNI GCATC 3 cut(s) 13, 38, 70
SfuI TTCGAA 1 cut(s) 186
SgeI CNNG 6 cut(s) 25, 114, 126, 158, 162, 170
SmlI CTYRAG 1 cut(s) 144
SmoI CTYRAG 1 cut(s) 144
Sse9I AATT 1 cut(s) 163
SsiI CCGC 1 cut(s) 27
SspMI CTAG 1 cut(s) 102
TaqI TCGA 2 cut(s) 133, 186
TasI AATT 1 cut(s) 163
TauI GCSGC 1 cut(s) 29
TfiI GAWTC 1 cut(s) 169
TseI GCWGC 3 cut(s) 58, 154, 194
TspDTI ATGAA 2 cut(s) 17, 99
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.