Rh3CG263300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0001336
Physical Location & Seq
Reverse (-)
25698000 .. 25698474
475 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG263300.1

Sequence Viewer

Length: 206 bp
ATGGACAAATCTCTTGCAGTACTGTTGTTTCCTTCACCGAAAGGTCAAGAAGGTCAAGCTCACCGTCCTCCAGTTCTACAAGGTCGACGACTCCGGCAAGGTGCAAAAGCTGAGGAAGGAGTGAAAGAGAAGGCAGAGGGAGAGCATTTTTCTGGATTAAACCCTGGATGTTTAGGTATTTTTGGAGCTAAAAGGTACTATTGCAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.41

Weight (kDa)

9.39

Isoelectric Point (pI)

53.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 85
AfaI GTAC 2 cut(s) 21, 197
AjnI CCWGG 1 cut(s) 163
AluBI AGCT 3 cut(s) 59, 110, 188
AluI AGCT 3 cut(s) 59, 110, 188
AsuHPI GGTGA 2 cut(s) 27, 53
BbvCI CCTCAGC 1 cut(s) 111
BciT130I CCWGG 1 cut(s) 165
BmcAI AGTACT 1 cut(s) 21
Bme1390I CCNGG 1 cut(s) 165
BmrFI CCNGG 1 cut(s) 165
BpmI CTGGAG 1 cut(s) 54
Bpu10I CCTNAGC 1 cut(s) 111
BsaJI CCNNGG 1 cut(s) 163
Bse1I ACTGG 1 cut(s) 71
BseBI CCWGG 1 cut(s) 165
BseDI CCNNGG 1 cut(s) 163
BseGI GGATG 1 cut(s) 173
BseMII CTCAG 1 cut(s) 102
BseNI ACTGG 1 cut(s) 71
BsiSI CCGG 1 cut(s) 94
BspCNI CTCAG 1 cut(s) 103
BsrI ACTGG 1 cut(s) 71
BssECI CCNNGG 1 cut(s) 163
Bst2UI CCWGG 1 cut(s) 165
Bst4CI ACNGT 2 cut(s) 24, 65
BstDEI CTNAG 1 cut(s) 111
BstF5I GGATG 1 cut(s) 173
BstNI CCWGG 1 cut(s) 165
BstSCI CCNGG 1 cut(s) 163
BtsCI GGATG 1 cut(s) 173
Csp6I GTAC 2 cut(s) 20, 196
CviJI RGCY 3 cut(s) 59, 110, 188
CviKI_1 RGCY 3 cut(s) 59, 110, 188
CviQI GTAC 2 cut(s) 20, 196
DdeI CTNAG 1 cut(s) 111
EcoRII CCWGG 1 cut(s) 163
FblI GTMKAC 1 cut(s) 85
FokI GGATG 1 cut(s) 180
GsuI CTGGAG 1 cut(s) 54
HapII CCGG 1 cut(s) 94
HincII GTYRAC 1 cut(s) 86
HindII GTYRAC 1 cut(s) 86
HinfI GANTC 1 cut(s) 90
HpaII CCGG 1 cut(s) 94
HphI GGTGA 2 cut(s) 27, 53
Hpy166II GTNNAC 1 cut(s) 86
Hpy188III TCNNGA 2 cut(s) 47, 153
Hpy8I GTNNAC 1 cut(s) 86
Hpy99I CGWCG 1 cut(s) 90
HpyAV CCTTC 4 cut(s) 42, 44, 110, 124
HpyCH4III ACNGT 2 cut(s) 24, 65
HpyCH4V TGCA 3 cut(s) 17, 104, 204
HpyF3I CTNAG 1 cut(s) 111
LmnI GCTCC 1 cut(s) 185
LpnPI CCDG 5 cut(s) 84, 107, 138, 150, 177
MlyI GAGTC 1 cut(s) 84
MnlI CCTC 3 cut(s) 78, 106, 130
MseI TTAA 1 cut(s) 158
MspI CCGG 1 cut(s) 94
MspR9I CCNGG 1 cut(s) 165
MvaI CCWGG 1 cut(s) 165
PleI GAGTC 1 cut(s) 84
PpsI GAGTC 1 cut(s) 84
Psp6I CCWGG 1 cut(s) 163
PspGI CCWGG 1 cut(s) 163
RsaI GTAC 2 cut(s) 21, 197
RsaNI GTAC 2 cut(s) 20, 196
SalI GTCGAC 1 cut(s) 84
SaqAI TTAA 1 cut(s) 158
ScaI AGTACT 1 cut(s) 21
SchI GAGTC 1 cut(s) 84
ScrFI CCNGG 1 cut(s) 165
SetI ASST 9 cut(s) 46, 55, 61, 85, 103, 112, 178, 190, 197
StyD4I CCNGG 1 cut(s) 163
TaaI ACNGT 2 cut(s) 24, 65
TaqI TCGA 1 cut(s) 85
TatI WGTACW 1 cut(s) 19
Tru1I TTAA 1 cut(s) 158
Tru9I TTAA 1 cut(s) 158
XmiI GTMKAC 1 cut(s) 85
ZrmI AGTACT 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.