RLG00000006084

Zinc finger BED domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
Physical Location & Seq
Forward (+)
4205978 .. 4206455
478 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000006084

Sequence Viewer

Length: 354 bp
ATGATAGCTAATGTTCTTGACCCAAGATACAAGCTACAGTGGGCAAAAGTAGCTATGGAAAAGGTCCATGCAAGCTATGAAACGATTAACTCAATACAAGGGGACTTGAAGAAAATATTGTTGAACATGTATGATGAATATAAGGGCAGCGAAGGCAGCAACCAAACTGAACAAAGCATGGCAGAAGATTTTGGATTGGATGGGGATGACTTGGAGAACCTTGATGAAGTGAGCAGGCAAATAGCAAGGGAGAGGATGGATGAACAATCCCAATGCATAAGAAATGAAGTTGATCAATATTTATCGGATAGGTATGTGAGCCTCTTCGCAAAAAATTTTGAAATTCACAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

118

Amino Acids

13.63

Weight (kDa)

4.55

Isoelectric Point (pI)

31.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 334, 342
AflIII ACRYGT 1 cut(s) 126
AgsI TTSAA 3 cut(s) 109, 124, 341
AluBI AGCT 4 cut(s) 8, 34, 53, 75
AluI AGCT 4 cut(s) 8, 34, 53, 75
ApeKI GCWGC 2 cut(s) 147, 156
ApoI RAATTY 2 cut(s) 334, 342
AspS9I GGNCC 1 cut(s) 64
AvaII GGWCC 1 cut(s) 64
BbvI GCAGC 2 cut(s) 159, 168
BccI CCATC 2 cut(s) 194, 250
BclI TGATCA 1 cut(s) 292
BfmI CTRYAG 1 cut(s) 35
BisI GCNGC 2 cut(s) 148, 157
BlsI GCNGC 2 cut(s) 149, 158
Bme18I GGWCC 1 cut(s) 64
BmgT120I GGNCC 1 cut(s) 64
BseGI GGATG 4 cut(s) 205, 211, 261, 265
BseXI GCAGC 2 cut(s) 159, 168
BslFI GGGAC 1 cut(s) 116
BsmFI GGGAC 1 cut(s) 116
Bsp143I GATC 1 cut(s) 292
BssMI GATC 1 cut(s) 292
Bst4CI ACNGT 1 cut(s) 39
Bst6I CTCTTC 1 cut(s) 329
BstC8I GCNNGC 2 cut(s) 73, 236
BstF5I GGATG 4 cut(s) 205, 211, 261, 265
BstKTI GATC 1 cut(s) 295
BstMBI GATC 1 cut(s) 292
BstMWI GCNNNNNNNGC 3 cut(s) 50, 153, 156
BstNSI RCATGY 1 cut(s) 130
BstSFI CTRYAG 1 cut(s) 35
BstV1I GCAGC 2 cut(s) 159, 168
BtsCI GGATG 4 cut(s) 205, 211, 261, 265
BtsIMutI CAGTG 1 cut(s) 44
Cac8I GCNNGC 2 cut(s) 73, 236
Cfr13I GGNCC 1 cut(s) 64
CviAII CATG 3 cut(s) 68, 127, 178
CviJI RGCY 5 cut(s) 8, 34, 53, 75, 321
CviKI_1 RGCY 5 cut(s) 8, 34, 53, 75, 321
DpnI GATC 1 cut(s) 294
DpnII GATC 1 cut(s) 292
Eam1104I CTCTTC 1 cut(s) 329
EarI CTCTTC 1 cut(s) 329
Eco47I GGWCC 1 cut(s) 64
EcoT22I ATGCAT 1 cut(s) 278
FaeI CATG 3 cut(s) 71, 130, 181
FaiI YATR 9 cut(s) 56, 69, 78, 128, 132, 141, 179, 278, 315
FaqI GGGAC 1 cut(s) 116
FatI CATG 3 cut(s) 67, 126, 177
FbaI TGATCA 1 cut(s) 292
Fnu4HI GCNGC 2 cut(s) 148, 157
FokI GGATG 4 cut(s) 212, 218, 268, 272
Fsp4HI GCNGC 2 cut(s) 148, 157
GluI GCNGC 2 cut(s) 148, 157
Hin1II CATG 3 cut(s) 71, 130, 181
Hpy188I TCNGA 1 cut(s) 307
Hpy188III TCNNGA 1 cut(s) 17
HpyAV CCTTC 1 cut(s) 146
HpyCH4III ACNGT 1 cut(s) 39
HpyCH4V TGCA 2 cut(s) 71, 276
HpyF10VI GCNNNNNNNGC 3 cut(s) 50, 153, 156
Hsp92II CATG 3 cut(s) 71, 130, 181
Ksp22I TGATCA 1 cut(s) 292
Kzo9I GATC 1 cut(s) 292
LpnPI CCDG 1 cut(s) 220
Lsp1109I GCAGC 2 cut(s) 159, 168
MalI GATC 1 cut(s) 294
MboI GATC 1 cut(s) 292
MboII GAAGA 3 cut(s) 121, 197, 316
MluCI AATT 2 cut(s) 334, 342
MnlI CCTC 2 cut(s) 246, 332
Mph1103I ATGCAT 1 cut(s) 278
MseI TTAA 1 cut(s) 87
MwoI GCNNNNNNNGC 3 cut(s) 50, 153, 156
NdeII GATC 1 cut(s) 292
NlaIII CATG 3 cut(s) 71, 130, 181
NsiI ATGCAT 1 cut(s) 278
NspI RCATGY 1 cut(s) 130
PciI ACATGT 1 cut(s) 126
PkrI GCNGC 2 cut(s) 149, 158
PscI ACATGT 1 cut(s) 126
PspPI GGNCC 1 cut(s) 64
SaqAI TTAA 1 cut(s) 87
SatI GCNGC 2 cut(s) 148, 157
Sau3AI GATC 1 cut(s) 292
Sau96I GGNCC 1 cut(s) 64
SetI ASST 7 cut(s) 10, 36, 55, 66, 77, 222, 314
SfcI CTRYAG 1 cut(s) 35
SinI GGWCC 1 cut(s) 64
Sse9I AATT 2 cut(s) 334, 342
SspI AATATT 2 cut(s) 117, 299
TaaI ACNGT 1 cut(s) 39
TasI AATT 2 cut(s) 334, 342
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
TscAI CASTG 1 cut(s) 44
TseI GCWGC 2 cut(s) 147, 156
TspDTI ATGAA 5 cut(s) 93, 150, 240, 276, 300
TspRI CASTG 1 cut(s) 44
VpaK11BI GGWCC 1 cut(s) 64
XapI RAATTY 2 cut(s) 334, 342
XceI RCATGY 1 cut(s) 130
Zsp2I ATGCAT 1 cut(s) 278
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.