RchiOBHm_Chr7g0199701

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0001336
Physical Location & Seq
Forward (+)
17740625 .. 17742991
2367 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ17872

Sequence Viewer

Length: 198 bp
ATGGGTACTCAAAGTGCTAACCTCAGTCAAGCTAGTAGCTCTAGCCCTTCAATAAGTTCTGCACCTAATATGACGAATACTGCAGCTTTAGATCATTCCCCTTTAGGACAACCACCCGTAGGTCAAACACTCCCACCTTTAGGTGCTTCTGGTTCAGGTGGAAGCCATTATTTGCACTTCGGATTGGTTAAAATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

6.42

Weight (kDa)

6.81

Isoelectric Point (pI)

61.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 7
AfiI CCNNNNNNNGG 2 cut(s) 119, 140
AgsI TTSAA 1 cut(s) 51
AluBI AGCT 3 cut(s) 32, 39, 86
AluI AGCT 3 cut(s) 32, 39, 86
ApeKI GCWGC 1 cut(s) 83
BbvI GCAGC 1 cut(s) 95
BfaI CTAG 2 cut(s) 33, 42
BfmI CTRYAG 1 cut(s) 81
BisI GCNGC 1 cut(s) 84
BlsI GCNGC 1 cut(s) 85
Bsc4I CCNNNNNNNGG 2 cut(s) 119, 140
BseLI CCNNNNNNNGG 2 cut(s) 119, 140
BseMII CTCAG 1 cut(s) 37
BseXI GCAGC 1 cut(s) 95
BsgI GTGCAG 1 cut(s) 45
BslI CCNNNNNNNGG 2 cut(s) 119, 140
Bsp143I GATC 1 cut(s) 91
BspCNI CTCAG 1 cut(s) 36
BspMAI CTGCAG 1 cut(s) 85
BssMI GATC 1 cut(s) 91
BstDEI CTNAG 1 cut(s) 23
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstSFI CTRYAG 1 cut(s) 81
BstV1I GCAGC 1 cut(s) 95
Csp6I GTAC 1 cut(s) 6
CviJI RGCY 5 cut(s) 32, 39, 45, 86, 165
CviKI_1 RGCY 5 cut(s) 32, 39, 45, 86, 165
CviQI GTAC 1 cut(s) 6
DdeI CTNAG 1 cut(s) 23
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
FaiI YATR 1 cut(s) 71
Fnu4HI GCNGC 1 cut(s) 84
Fsp4HI GCNGC 1 cut(s) 84
FspBI CTAG 2 cut(s) 33, 42
GluI GCNGC 1 cut(s) 84
Hpy188I TCNGA 2 cut(s) 182, 197
HpyAV CCTTC 1 cut(s) 57
HpyCH4V TGCA 3 cut(s) 62, 83, 175
HpyF3I CTNAG 1 cut(s) 23
Kzo9I GATC 1 cut(s) 91
LpnPI CCDG 2 cut(s) 135, 141
Lsp1109I GCAGC 1 cut(s) 95
MaeI CTAG 2 cut(s) 33, 42
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MnlI CCTC 1 cut(s) 32
MseI TTAA 1 cut(s) 189
NdeII GATC 1 cut(s) 91
PkrI GCNGC 1 cut(s) 85
PstI CTGCAG 1 cut(s) 85
RsaI GTAC 1 cut(s) 7
RsaNI GTAC 1 cut(s) 6
SaqAI TTAA 1 cut(s) 189
SatI GCNGC 1 cut(s) 84
Sau3AI GATC 1 cut(s) 91
SetI ASST 9 cut(s) 24, 34, 41, 67, 88, 124, 139, 145, 160
SfcI CTRYAG 1 cut(s) 81
SgeI CNNG 6 cut(s) 41, 45, 54, 128, 162, 168
SspMI CTAG 2 cut(s) 33, 42
Tru1I TTAA 1 cut(s) 189
Tru9I TTAA 1 cut(s) 189
TseI GCWGC 1 cut(s) 83
XspI CTAG 2 cut(s) 33, 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.