RLG00000036228

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Reverse (-)
77655055 .. 77655372
318 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000036228

Sequence Viewer

Length: 318 bp
ATGGCTTCTACAAGTAGGTCAGGAAGTCATTGTTGTTCATCCCCTTCCATAACTTCTAAAATGGTTACTGCAAGTTGTCAATCAATAGGCGTTCCCCTAAATAATAACCAAAACACTATACCACCAGTAGAAAACATTATCCCTAACTCAGTTCCCATTCCAACCCCAACTGAAACACCAAATCCAGATCCTGAATCGGTGGAAGCTACTGCGGGGTTGGGGAAAAGAAAAATACAAAATAAGACCACAAAGGGTAGGAAACAAAGTCGAGTGTGGGACTATTTCACAAGGCCTTTGCTCCCTGATGGCAAAGCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

11.23

Weight (kDa)

9.45

Isoelectric Point (pI)

60.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 212
AclWI GGATC 1 cut(s) 182
AluBI AGCT 1 cut(s) 206
AluI AGCT 1 cut(s) 206
AlwI GGATC 1 cut(s) 182
AlwNI CAGNNNCTG 1 cut(s) 191
AoxI GGCC 1 cut(s) 290
BccI CCATC 1 cut(s) 299
Bse1I ACTGG 1 cut(s) 125
BseGI GGATG 1 cut(s) 38
BseMII CTCAG 1 cut(s) 162
BseNI ACTGG 1 cut(s) 125
BshFI GGCC 1 cut(s) 292
BslFI GGGAC 1 cut(s) 290
BsmFI GGGAC 1 cut(s) 290
BsnI GGCC 1 cut(s) 292
Bsp143I GATC 1 cut(s) 187
BspACI CCGC 1 cut(s) 212
BspANI GGCC 1 cut(s) 292
BspCNI CTCAG 1 cut(s) 161
BspPI GGATC 1 cut(s) 182
BsrI ACTGG 1 cut(s) 125
BssMI GATC 1 cut(s) 187
BstDEI CTNAG 1 cut(s) 148
BstF5I GGATG 1 cut(s) 38
BstKTI GATC 1 cut(s) 190
BstMBI GATC 1 cut(s) 187
BstX2I RGATCY 1 cut(s) 187
BstYI RGATCY 1 cut(s) 187
BsuRI GGCC 1 cut(s) 292
BtsCI GGATG 1 cut(s) 38
CaiI CAGNNNCTG 1 cut(s) 191
CviJI RGCY 4 cut(s) 5, 206, 292, 314
CviKI_1 RGCY 4 cut(s) 5, 206, 292, 314
DdeI CTNAG 1 cut(s) 148
DpnI GATC 1 cut(s) 189
DpnII GATC 1 cut(s) 187
Eco147I AGGCCT 1 cut(s) 292
FaiI YATR 2 cut(s) 50, 119
FaqI GGGAC 1 cut(s) 290
FauI CCCGC 1 cut(s) 205
FokI GGATG 1 cut(s) 25
HaeIII GGCC 1 cut(s) 292
HinfI GANTC 1 cut(s) 194
Hpy188III TCNNGA 3 cut(s) 21, 185, 191
HpyAV CCTTC 1 cut(s) 54
HpyCH4V TGCA 1 cut(s) 71
HpyF3I CTNAG 1 cut(s) 148
Kzo9I GATC 1 cut(s) 187
LmnI GCTCC 1 cut(s) 303
LpnPI CCDG 4 cut(s) 6, 138, 198, 204
MaeIII GTNAC 1 cut(s) 64
MalI GATC 1 cut(s) 189
MboI GATC 1 cut(s) 187
MflI RGATCY 1 cut(s) 187
MmeI TCCRAC 1 cut(s) 185
NdeII GATC 1 cut(s) 187
PceI AGGCCT 1 cut(s) 292
PfeI GAWTC 1 cut(s) 194
PstNI CAGNNNCTG 1 cut(s) 191
PsuI RGATCY 1 cut(s) 187
Sau3AI GATC 1 cut(s) 187
SetI ASST 2 cut(s) 20, 208
SseBI AGGCCT 1 cut(s) 292
SsiI CCGC 1 cut(s) 212
StuI AGGCCT 1 cut(s) 292
TaqI TCGA 1 cut(s) 268
TfiI GAWTC 1 cut(s) 194
TspDTI ATGAA 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.