Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002402.1

Orthogroup ID

OG0001336

Physical Location & Seq

Genomic Coordinates Forward (+)

15285 .. 15581

Gene Structure 297 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002402.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 297 bp

atgaagaccaagttcaacaaatattggggaagcttcgaatcggtgaacaagataatcatgatagctaatgttcttgacccaagatacaagttgcagtgggaaaaattagctatggaaaagatcaatacaagctatgagacgattaactcaattcaaggggagttgaagaaaatattgctaaatatgtataatgaatataagggcagtgagggaagcaaccaaactgacctatgggagaagattttggatcggaaggggatgacttggagaaccttgatgaagtcagcaggcaaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF4413 Dimer_Tnp_hAT zf-BED

Protein Analysis

98

Amino Acids

11.59

Weight (kDa)

9.55

Isoelectric Point (pI)

12.66

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001336)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g25742 FvH4_6g20421
pyrus_communis	pycom05g20100 pycom11g13300
rosa_chinensis	RchiOBHm_Chr2g0102801 RchiOBHm_Chr2g0136641 RchiOBHm_Chr2g0154011 RchiOBHm_Chr5g0006251 RchiOBHm_Chr5g0052451 RchiOBHm_Chr7g0199701
rosa_laevigata	RLG00000006084 RLG00000012510 RLG00000012676 RLG00000019816 RLG00000034232 RLG00000034234 RLG00000034714 RLG00000035988 RLG00000036228
rosa_multiflora	Rmu_co8336117.1_g000001 Rmu_sc0000344.1_g000001 Rmu_sc0000899.1_g000001 Rmu_sc0001153.1_g000001 Rmu_sc0001501.1_g000021 Rmu_sc0001738.1_g000014 Rmu_sc0002402.1_g000002 Rmu_sc0002480.1_g000015 Rmu_sc0002885.1_g000004 Rmu_sc0005996.1_g000032 Rmu_sc0006458.1_g000010 Rmu_sc0012624.1_g000001 Rmu_sc0013184.1_g000003 Rmu_sc0041192.1_g000001
rosa_roxburghii	Rroxscaffold_1G00027780 Rroxscaffold_1G00055130 Rroxscaffold_4G00305320 Rroxscaffold_7G00190260 Rroxscaffold_7G00210380
rosa_rugosa	Rorug05G0269100 Rorug05G0324900
rosa_samantha	Rh1BG037500 Rh3CG170900 Rh3CG263300 Rh3DG302000 Rh4BG221700 Rh5AG145200 Rh5AG179700 Rh5CG344300 Rh7AG471400 Rh7BG274800 Rh7BG358400 Rh7BG399400 Rh7CG276500
rosa_wichuraiana	Rw1G014120

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	255
AgsI	TTSAA	3 cut(s)	16, 155, 166
AluBI	AGCT	4 cut(s)	33, 65, 110, 132
AluI	AGCT	4 cut(s)	33, 65, 110, 132
Alw26I	GTCTC	1 cut(s)	131
AlwI	GGATC	1 cut(s)	255
AsuHPI	GGTGA	1 cut(s)	55
AsuII	TTCGAA	1 cut(s)	36
BbsI	GAAGAC	1 cut(s)	11
BcoDI	GTCTC	1 cut(s)	131
BpiI	GAAGAC	1 cut(s)	11
Bpu14I	TTCGAA	1 cut(s)	36
BseGI	GGATG	1 cut(s)	264
BsmAI	GTCTC	1 cut(s)	131
BsmBI	CGTCTC	1 cut(s)	131
Bsp119I	TTCGAA	1 cut(s)	36
Bsp143I	GATC	2 cut(s)	120, 247
BspHI	TCATGA	1 cut(s)	57
BspPI	GGATC	1 cut(s)	255
BspT104I	TTCGAA	1 cut(s)	36
BssMI	GATC	2 cut(s)	120, 247
BstBI	TTCGAA	1 cut(s)	36
BstC8I	GCNNGC	1 cut(s)	289
BstF5I	GGATG	1 cut(s)	264
BstKTI	GATC	2 cut(s)	123, 250
BstMAI	GTCTC	1 cut(s)	131
BstMBI	GATC	2 cut(s)	120, 247
BstV2I	GAAGAC	1 cut(s)	11
BtsCI	GGATG	1 cut(s)	264
BtsI	GCAGTG	2 cut(s)	101, 211
BtsIMutI	CAGTG	2 cut(s)	101, 211
Cac8I	GCNNGC	1 cut(s)	289
CciI	TCATGA	1 cut(s)	57
CviAII	CATG	1 cut(s)	58
CviJI	RGCY	4 cut(s)	33, 65, 110, 132
CviKI_1	RGCY	4 cut(s)	33, 65, 110, 132
DpnI	GATC	2 cut(s)	122, 249
DpnII	GATC	2 cut(s)	120, 247
Esp3I	CGTCTC	1 cut(s)	131
FaeI	CATG	1 cut(s)	61
FaiI	YATR	7 cut(s)	59, 113, 135, 185, 189, 198, 232
FatI	CATG	1 cut(s)	57
FokI	GGATG	1 cut(s)	271
Hin1II	CATG	1 cut(s)	61
HindIII	AAGCTT	1 cut(s)	31
HinfI	GANTC	1 cut(s)	38
HphI	GGTGA	1 cut(s)	55
Hpy166II	GTNNAC	1 cut(s)	46
Hpy188I	TCNGA	1 cut(s)	252
Hpy188III	TCNNGA	2 cut(s)	58, 74
Hpy8I	GTNNAC	1 cut(s)	46
HpyAV	CCTTC	1 cut(s)	247
HpyCH4V	TGCA	1 cut(s)	94
Hsp92II	CATG	1 cut(s)	61
Kzo9I	GATC	2 cut(s)	120, 247
LpnPI	CCDG	1 cut(s)	273
MalI	GATC	2 cut(s)	122, 249
MboI	GATC	2 cut(s)	120, 247
MboII	GAAGA	3 cut(s)	16, 178, 250
MluCI	AATT	2 cut(s)	104, 150
MnlI	CCTC	1 cut(s)	202
MseI	TTAA	1 cut(s)	144
NdeII	GATC	2 cut(s)	120, 247
NlaIII	CATG	1 cut(s)	61
NspV	TTCGAA	1 cut(s)	36
PagI	TCATGA	1 cut(s)	57
PfeI	GAWTC	1 cut(s)	38
SaqAI	TTAA	1 cut(s)	144
Sau3AI	GATC	2 cut(s)	120, 247
SetI	ASST	6 cut(s)	35, 67, 112, 134, 231, 275
SfuI	TTCGAA	1 cut(s)	36
Sse9I	AATT	2 cut(s)	104, 150
SspI	AATATT	2 cut(s)	23, 174
TaqI	TCGA	1 cut(s)	36
TasI	AATT	2 cut(s)	104, 150
TfiI	GAWTC	1 cut(s)	38
Tru1I	TTAA	1 cut(s)	144
Tru9I	TTAA	1 cut(s)	144
TscAI	CASTG	2 cut(s)	101, 211
TspDTI	ATGAA	3 cut(s)	17, 207, 293
TspRI	CASTG	2 cut(s)	101, 211

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.