Basic Information

Type: gene

Biological Identity

Species

rosa_laevigata

Chromosome

Chr1

Orthogroup ID

OG0000827

Physical Location & Seq

Genomic Coordinates Reverse (-)

47043156 .. 47044052

Gene Structure 897 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

RLM00000003321

Sequence Viewer

CDS Protein Promoter (2k)

Length: 897 bp

ATGCCCAACACCACTGGTGCAATCGTCACTTACCAGAGACGGTCAGGTCAAACTATAGAGACCAACCCTGAAGCATTTCAGGATCTAGGACCAACACTCGCAGACCATTTAGAGCAAAAAGAGAATCATCATGGTCAACGAAAGAAGTTCAAATCCAAGCTAACAGCAATGGAAAGTCTTGATGAGTTGGCTCTCACTTCCCAGCATCTTGTGGTGGATCCTTACATTCTAGTAAAGCCTCCACAGCTCAATCCAGCAGCAGTGGGACAATTGCCTCAAACAATAAAAGAGCCGCCTCAGAAACAACAGCTGCTGGGCCATATGAAACTGCGCTCATGCAGCCAAGCTGCATTGCAATCTGAACCTGATGTTTCGATAGTGGGACAATTGCCTCAAACAACAAAAGAGCTGCCACAGAAACAGCAGCTGCTGTGCTGTATGAAACTATGCTCATGCGGCCAAGCTGCATCGCAATCTGAACCTGATGTTTCGATGATTGATACGCTGCCCGCAAAGCACCATTCTGAGCAGCCACAAGAACAGAAGCATCCTAGGCAGCCACAGAAGCAAAGAGGGAGGACTCCTAAACCAAAACTGGATAGAGCTGGGCCTGTTAAGCATCAAAAGCTGCAGGAACAACCAAAGAGACGAGGGAGGCCCCCTAAGTTGGATGTAAATACTATATCAGGGAGAAAATTGATCTCAAAGAACATACAGAAGCAACCAAAGAGTCTAGAGAAGGCAAAGTCTCGAAAAGTGATCAAAGGAAAACTACAGAGTCAAGTGAGGGGAAAGCCTCAAAAAGTGACTCAAGGAACACCACAGAGTCAAGTGAGGGGAAGGCTTCAAAAAATGTCTGAAGGAACAGTAAAGAGTCAAGTGAGGGAGAGGGATTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Linker_histone

Protein Analysis

299

Amino Acids

33.39

Weight (kDa)

10.1

Isoelectric Point (pI)

60.27

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000827)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G08780
fragaria_vesca	FvH4_5g27971
malus_domestica	MD06G1045800.v1.1
prunus_persica	Prupe.5G053600_v2.0.a1 Prupe.5G053600_v2.0.a1
pyrus_communis	pycom06g03880
rosa_chinensis	RchiOBHm_Chr7g0206261 RchiOBHm_Chr7g0206321 RchiOBHm_Chr7g0206331
rosa_laevigata	RLG00000003320 RLG00000003321 RLG00000003322 RLG00000003323 RLG00000003332 RLG00000003335
rosa_multiflora	Rmu_co8193150.1_g000001 Rmu_co8257597.1_g000001 Rmu_sc0000076.1_g000010 Rmu_sc0000076.1_g000011 Rmu_sc0004084.1_g000032 Rmu_sc0004084.1_g000049 Rmu_sc0005065.1_g000013 Rmu_sc0005065.1_g000014 Rmu_sc0006841.1_g000008 Rmu_sc0006841.1_g000010 Rmu_sc0006841.1_g000011 Rmu_sc0007739.1_g000013 Rmu_sc0007739.1_g000014
rosa_roxburghii	Rroxscaffold_3G00251630 Rroxscaffold_3G00251640 Rroxscaffold_3G00251710 Rroxscaffold_3G00251720 Rroxscaffold_3G00251730 Rroxscaffold_3G00251740 Rroxscaffold_3G00251800
rosa_rugosa	Rorug07G0096200
rosa_samantha	Rh7AG226900 Rh7AG227000 Rh7AG227100 Rh7AG227200 Rh7AG228200 Rh7AG228300 Rh7BG223200 Rh7BG223300 Rh7BG224500 Rh7BG224600 Rh7CG241200 Rh7CG241300 Rh7CG241400 Rh7CG241500 Rh7CG241600 Rh7CG242800 Rh7DG234300 Rh7DG234400 Rh7DG234500 Rh7DG234600 Rh7DG234700 Rh7DG234800 Rh7DG235400 Rh7DG235500 Rh7DG235600
rosa_wichuraiana	Rw7G019490 Rw7G019520 Rw7G019560 Rw7G019600 Rw7G019610 Rw7G019660 Rw7G019670

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	45
AciI	CCGC	3 cut(s)	293, 456, 510
AclWI	GGATC	3 cut(s)	90, 212, 225
AcoI	YGGCCR	1 cut(s)	457
AcuI	CTGAAG	2 cut(s)	90, 879
AfiI	CCNNNNNNNGG	1 cut(s)	667
AgsI	TTSAA	2 cut(s)	151, 848
AluBI	AGCT	9 cut(s)	160, 247, 310, 347, 409, 427, 464, 605, 628
AluI	AGCT	9 cut(s)	160, 247, 310, 347, 409, 427, 464, 605, 628
Alw26I	GTCTC	4 cut(s)	31, 53, 640, 753
AlwI	GGATC	3 cut(s)	90, 212, 225
AlwNI	CAGNNNCTG	3 cut(s)	313, 427, 430
AoxI	GGCC	4 cut(s)	316, 457, 608, 656
Asp700I	GAANNNNTTC	1 cut(s)	75
AspA2I	CCTAGG	1 cut(s)	551
AspLEI	GCGC	1 cut(s)	333
AspS9I	GGNCC	4 cut(s)	89, 316, 608, 657
AvaII	GGWCC	1 cut(s)	89
AvrII	CCTAGG	1 cut(s)	551
BamHI	GGATCC	1 cut(s)	217
BclI	TGATCA	1 cut(s)	759
BcoDI	GTCTC	4 cut(s)	31, 53, 640, 753
BfaI	CTAG	4 cut(s)	86, 230, 552, 734
BfmI	CTRYAG	3 cut(s)	54, 629, 773
BlnI	CCTAGG	1 cut(s)	551
Bme18I	GGWCC	1 cut(s)	89
BmgT120I	GGNCC	4 cut(s)	89, 316, 608, 657
BmiI	GGNNCC	2 cut(s)	219, 659
BmsI	GCATC	4 cut(s)	214, 476, 556, 628
BpuEI	CTTGAG	1 cut(s)	795
BsaI	GGTCTC	1 cut(s)	53
BsaJI	CCNNGG	1 cut(s)	551
Bsc4I	CCNNNNNNNGG	1 cut(s)	667
Bse1I	ACTGG	2 cut(s)	19, 600
Bse3DI	GCAATG	2 cut(s)	174, 350
BseDI	CCNNGG	1 cut(s)	551
BseGI	GGATG	2 cut(s)	547, 676
BseLI	CCNNNNNNNGG	1 cut(s)	667
BseMI	GCAATG	2 cut(s)	174, 350
BseMII	CTCAG	2 cut(s)	311, 516
BseNI	ACTGG	2 cut(s)	19, 600
BseYI	CCCAGC	3 cut(s)	201, 313, 605
BshFI	GGCC	4 cut(s)	318, 459, 610, 658
BslFI	GGGAC	2 cut(s)	279, 396
BslI	CCNNNNNNNGG	1 cut(s)	667
BsmAI	GTCTC	4 cut(s)	31, 53, 640, 753
BsmBI	CGTCTC	2 cut(s)	31, 640
BsmFI	GGGAC	2 cut(s)	279, 396
BsnI	GGCC	4 cut(s)	318, 459, 610, 658
Bso31I	GGTCTC	1 cut(s)	53
Bsp143I	GATC	4 cut(s)	82, 217, 699, 759
BspACI	CCGC	3 cut(s)	293, 456, 510
BspANI	GGCC	4 cut(s)	318, 459, 610, 658
BspCNI	CTCAG	2 cut(s)	310, 517
BspLI	GGNNCC	2 cut(s)	219, 659
BspMAI	CTGCAG	1 cut(s)	633
BspPI	GGATC	3 cut(s)	90, 212, 225
BspTNI	GGTCTC	1 cut(s)	53
BsrDI	GCAATG	2 cut(s)	174, 350
BsrI	ACTGG	2 cut(s)	19, 600
BssECI	CCNNGG	1 cut(s)	551
BssMI	GATC	4 cut(s)	82, 217, 699, 759
BssT1I	CCWWGG	1 cut(s)	551
Bst4CI	ACNGT	2 cut(s)	42, 868
BstC8I	GCNNGC	1 cut(s)	510
BstDEI	CTNAG	3 cut(s)	297, 525, 663
BstF5I	GGATG	2 cut(s)	547, 676
BstHHI	GCGC	1 cut(s)	333
BstKTI	GATC	4 cut(s)	85, 220, 702, 762
BstMAI	GTCTC	4 cut(s)	31, 53, 640, 753
BstMBI	GATC	4 cut(s)	82, 217, 699, 759
BstMWI	GCNNNNNNNGC	8 cut(s)	244, 339, 456, 514, 553, 565, 616, 625
BstSFI	CTRYAG	3 cut(s)	54, 629, 773
BstX2I	RGATCY	2 cut(s)	82, 217
BstYI	RGATCY	2 cut(s)	82, 217
BsuRI	GGCC	4 cut(s)	318, 459, 610, 658
BtgZI	GCGATG	1 cut(s)	453
BtsCI	GGATG	2 cut(s)	547, 676
BtsI	GCAGTG	1 cut(s)	267
BtsIMutI	CAGTG	2 cut(s)	12, 267
Cac8I	GCNNGC	1 cut(s)	510
CaiI	CAGNNNCTG	3 cut(s)	313, 427, 430
CfoI	GCGC	1 cut(s)	333
Cfr13I	GGNCC	4 cut(s)	89, 316, 608, 657
CviAII	CATG	3 cut(s)	131, 336, 453
DdeI	CTNAG	3 cut(s)	297, 525, 663
DpnI	GATC	4 cut(s)	84, 219, 701, 761
DpnII	GATC	4 cut(s)	82, 217, 699, 759
DrdI	GACNNNNNNGTC	1 cut(s)	45
DseDI	GACNNNNNNGTC	1 cut(s)	45
EaeI	YGGCCR	1 cut(s)	457
Eco130I	CCWWGG	1 cut(s)	551
Eco31I	GGTCTC	1 cut(s)	53
Eco47I	GGWCC	1 cut(s)	89
Eco57I	CTGAAG	2 cut(s)	90, 879
EcoO109I	RGGNCCY	1 cut(s)	657
EcoT14I	CCWWGG	1 cut(s)	551
ErhI	CCWWGG	1 cut(s)	551
Esp3I	CGTCTC	2 cut(s)	31, 640
FaeI	CATG	3 cut(s)	134, 339, 456
FaqI	GGGAC	2 cut(s)	279, 396
FatI	CATG	3 cut(s)	130, 335, 452
FauI	CCCGC	1 cut(s)	517
FauNDI	CATATG	1 cut(s)	321
FbaI	TGATCA	1 cut(s)	759
FokI	GGATG	2 cut(s)	534, 683
FspBI	CTAG	4 cut(s)	86, 230, 552, 734
GlaI	GCGC	1 cut(s)	332
GsaI	CCCAGC	3 cut(s)	205, 317, 609
HaeIII	GGCC	4 cut(s)	318, 459, 610, 658
HhaI	GCGC	1 cut(s)	333
Hin1II	CATG	3 cut(s)	134, 339, 456
Hin6I	GCGC	1 cut(s)	331
HinP1I	GCGC	1 cut(s)	331
HincII	GTYRAC	1 cut(s)	137
HindII	GTYRAC	1 cut(s)	137
HinfI	GANTC	7 cut(s)	124, 580, 730, 778, 808, 826, 874
Hpy166II	GTNNAC	1 cut(s)	137
Hpy188I	TCNGA	5 cut(s)	300, 361, 478, 526, 859
Hpy188III	TCNNGA	4 cut(s)	80, 179, 734, 750
Hpy8I	GTNNAC	1 cut(s)	137
HpyAV	CCTTC	3 cut(s)	733, 834, 854
HpyCH4III	ACNGT	2 cut(s)	42, 868
HpyCH4V	TGCA	6 cut(s)	20, 339, 350, 355, 467, 631
HpyF10VI	GCNNNNNNNGC	8 cut(s)	244, 339, 456, 514, 553, 565, 616, 625
HpyF3I	CTNAG	3 cut(s)	297, 525, 663
Hsp92II	CATG	3 cut(s)	134, 339, 456
HspAI	GCGC	1 cut(s)	331
Ksp22I	TGATCA	1 cut(s)	759
Kzo9I	GATC	4 cut(s)	82, 217, 699, 759
LweI	GCATC	4 cut(s)	214, 476, 556, 628
MaeI	CTAG	4 cut(s)	86, 230, 552, 734
MaeIII	GTNAC	2 cut(s)	25, 805
MalI	GATC	4 cut(s)	84, 219, 701, 761
MboI	GATC	4 cut(s)	82, 217, 699, 759
MfeI	CAATTG	2 cut(s)	269, 386
MflI	RGATCY	2 cut(s)	82, 217
MluCI	AATT	3 cut(s)	269, 386, 695
MlyI	GAGTC	6 cut(s)	574, 739, 787, 802, 835, 883
MmeI	TCCRAC	1 cut(s)	648
MroXI	GAANNNNTTC	1 cut(s)	75
MseI	TTAA	1 cut(s)	615
MspA1I	CMGCKG	2 cut(s)	310, 427
MunI	CAATTG	2 cut(s)	269, 386
MwoI	GCNNNNNNNGC	8 cut(s)	244, 339, 456, 514, 553, 565, 616, 625
NdeI	CATATG	1 cut(s)	321
NdeII	GATC	4 cut(s)	82, 217, 699, 759
NlaIII	CATG	3 cut(s)	134, 339, 456
NlaIV	GGNNCC	2 cut(s)	219, 659
NmuCI	GTSAC	2 cut(s)	25, 805
PdmI	GAANNNNTTC	1 cut(s)	75
PfeI	GAWTC	1 cut(s)	124
PleI	GAGTC	6 cut(s)	574, 738, 786, 802, 834, 882
PpsI	GAGTC	6 cut(s)	574, 738, 786, 802, 834, 882
PspFI	CCCAGC	3 cut(s)	201, 313, 605
PspN4I	GGNNCC	2 cut(s)	219, 659
PspPI	GGNCC	4 cut(s)	89, 316, 608, 657
PstI	CTGCAG	1 cut(s)	633
PstNI	CAGNNNCTG	3 cut(s)	313, 427, 430
PsuI	RGATCY	2 cut(s)	82, 217
PvuII	CAGCTG	2 cut(s)	310, 427
SaqAI	TTAA	1 cut(s)	615
Sau3AI	GATC	4 cut(s)	82, 217, 699, 759
Sau96I	GGNCC	4 cut(s)	89, 316, 608, 657
SchI	GAGTC	6 cut(s)	574, 739, 787, 802, 835, 883
SfaNI	GCATC	4 cut(s)	214, 476, 556, 628
SfcI	CTRYAG	3 cut(s)	54, 629, 773
SinI	GGWCC	1 cut(s)	89
SmlI	CTYRAG	1 cut(s)	810
SmoI	CTYRAG	1 cut(s)	810
Sse9I	AATT	3 cut(s)	269, 386, 695
SsiI	CCGC	3 cut(s)	293, 456, 510
SspMI	CTAG	4 cut(s)	86, 230, 552, 734
StyI	CCWWGG	1 cut(s)	551
TaaI	ACNGT	2 cut(s)	42, 868
TaqI	TCGA	3 cut(s)	374, 491, 751
TasI	AATT	3 cut(s)	269, 386, 695
TauI	GCSGC	2 cut(s)	295, 459
TfiI	GAWTC	1 cut(s)	124
Tru1I	TTAA	1 cut(s)	615
Tru9I	TTAA	1 cut(s)	615
TscAI	CASTG	2 cut(s)	19, 267
TseFI	GTSAC	2 cut(s)	25, 805
Tsp45I	GTSAC	2 cut(s)	25, 805
TspDTI	ATGAA	2 cut(s)	338, 455
TspRI	CASTG	2 cut(s)	19, 267
VpaK11BI	GGWCC	1 cut(s)	89
XbaI	TCTAGA	1 cut(s)	733
XmaJI	CCTAGG	1 cut(s)	551
XmnI	GAANNNNTTC	1 cut(s)	75
XspI	CTAG	4 cut(s)	86, 230, 552, 734

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.