Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000076.1

Orthogroup ID

OG0000827

Physical Location & Seq

Genomic Coordinates Reverse (-)

32361 .. 33578

Gene Structure 1218 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000076.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 921 bp

atgattgaagataaatatggctatacagatgtgcagcaagagagagtgaatggacatgaaaatcagaaacatatgcaagaagttgcgttgattgttgatgagcagaatgttgaagtcaagaagtatcaagtgaatgaagagcaagttgaagtgattgaacaaaagacagaacatgtgaagcgaagtgcagaaccaatacagcacatgaaggtgattgattgtcaaaatggatcttcaaagcaacaaaatgaacagaaagatgaagtgaatagacagcaaagtgaaaatcaaatccaagtaactgcagtggttgttgaaaagtctaatatttcagaacagacacgtaatgtgaatgaagaagaacaagttgaagtgactgcacagagagaatatgggcagcaaagtcaagtagctagtcaagaagagcaacataacaagattgacacaaaattgaaacacaaagtggctgatgagcgtattgaagaacagtgccaaactaaagaacaattgtgtgaagtgattgaacaacatagtcaaggtgtcaaaagagatatacagttacatggagaagcagttgaagcaattcggtctggaccagaggcacagcaaagtgatatgatttcagaacaaaatagaccgcaagaccaaattgaattaacaagtatgcaggagttattgtctaagaagcaagagaaagatgtggctactgtagtcaattcaaatatttctattgcaattcagaaattctcccaacatgtttcgtcaaacttgtctgaggtgctggaaaacaacgttaaggtgcagggaaaggtgcagaaactgctgcaaaatgacattaaggtgcaggaaaagacacataagctgctggaaaataacatgaaggtgcaggaaaagacacttcagcttgcatttcaagtttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Linker_histone

Protein Analysis

306

Amino Acids

35.31

Weight (kDa)

5.13

Isoelectric Point (pI)

55.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000827)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G08780
fragaria_vesca	FvH4_5g27971
malus_domestica	MD06G1045800.v1.1
prunus_persica	Prupe.5G053600_v2.0.a1 Prupe.5G053600_v2.0.a1
pyrus_communis	pycom06g03880
rosa_chinensis	RchiOBHm_Chr7g0206261 RchiOBHm_Chr7g0206321 RchiOBHm_Chr7g0206331
rosa_laevigata	RLG00000003320 RLG00000003321 RLG00000003322 RLG00000003323 RLG00000003332 RLG00000003335
rosa_multiflora	Rmu_co8193150.1_g000001 Rmu_co8257597.1_g000001 Rmu_sc0000076.1_g000010 Rmu_sc0000076.1_g000011 Rmu_sc0004084.1_g000032 Rmu_sc0004084.1_g000049 Rmu_sc0005065.1_g000013 Rmu_sc0005065.1_g000014 Rmu_sc0006841.1_g000008 Rmu_sc0006841.1_g000010 Rmu_sc0006841.1_g000011 Rmu_sc0007739.1_g000013 Rmu_sc0007739.1_g000014
rosa_roxburghii	Rroxscaffold_3G00251630 Rroxscaffold_3G00251640 Rroxscaffold_3G00251710 Rroxscaffold_3G00251720 Rroxscaffold_3G00251730 Rroxscaffold_3G00251740 Rroxscaffold_3G00251800
rosa_rugosa	Rorug07G0096200
rosa_samantha	Rh7AG226900 Rh7AG227000 Rh7AG227100 Rh7AG227200 Rh7AG228200 Rh7AG228300 Rh7BG223200 Rh7BG223300 Rh7BG224500 Rh7BG224600 Rh7CG241200 Rh7CG241300 Rh7CG241400 Rh7CG241500 Rh7CG241600 Rh7CG242800 Rh7DG234300 Rh7DG234400 Rh7DG234500 Rh7DG234600 Rh7DG234700 Rh7DG234800 Rh7DG235400 Rh7DG235500 Rh7DG235600
rosa_wichuraiana	Rw7G019490 Rw7G019520 Rw7G019560 Rw7G019600 Rw7G019610 Rw7G019660 Rw7G019670

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	638
AclI	AACGTT	1 cut(s)	792
AclWI	GGATC	1 cut(s)	238
AcsI	RAATTY	1 cut(s)	743
AcuI	CTGAAG	1 cut(s)	884
AdeI	CACNNNGTG	1 cut(s)	463
AflIII	ACRYGT	3 cut(s)	172, 341, 754
AluBI	AGCT	3 cut(s)	413, 862, 904
AluI	AGCT	3 cut(s)	413, 862, 904
AlwI	GGATC	1 cut(s)	238
AlwNI	CAGNNNCTG	1 cut(s)	820
ApeKI	GCWGC	4 cut(s)	34, 397, 823, 862
ApoI	RAATTY	1 cut(s)	743
Asp700I	GAANNNNTTC	1 cut(s)	582
AspS9I	GGNCC	1 cut(s)	593
AsuHPI	GGTGA	1 cut(s)	223
AvaII	GGWCC	1 cut(s)	593
BbvI	GCAGC	4 cut(s)	46, 409, 810, 849
BfaI	CTAG	1 cut(s)	414
BfmI	CTRYAG	2 cut(s)	303, 708
BisI	GCNGC	4 cut(s)	35, 398, 824, 863
BlsI	GCNGC	4 cut(s)	36, 399, 825, 864
Bme18I	GGWCC	1 cut(s)	593
BmgT120I	GGNCC	1 cut(s)	593
BsaAI	YACGTR	1 cut(s)	344
BsaXI	ACNNNNNCTCC	4 cut(s)	558, 588, 662, 692
BseMII	CTCAG	1 cut(s)	765
BseXI	GCAGC	4 cut(s)	46, 409, 810, 849
BsgI	GTGCAG	7 cut(s)	53, 207, 363, 821, 833, 863, 905
Bsp143I	GATC	1 cut(s)	230
BspACI	CCGC	1 cut(s)	638
BspCNI	CTCAG	1 cut(s)	766
BspMAI	CTGCAG	1 cut(s)	307
BspPI	GGATC	1 cut(s)	238
BspQI	GCTCTTC	2 cut(s)	132, 417
BssMI	GATC	1 cut(s)	230
Bst4CI	ACNGT	3 cut(s)	489, 558, 709
Bst6I	CTCTTC	2 cut(s)	132, 417
BstAPI	GCANNNNNTGC	1 cut(s)	820
BstBAI	YACGTR	1 cut(s)	344
BstC8I	GCNNGC	1 cut(s)	906
BstDEI	CTNAG	2 cut(s)	681, 774
BstKTI	GATC	1 cut(s)	233
BstMBI	GATC	1 cut(s)	230
BstMWI	GCNNNNNNNGC	2 cut(s)	578, 820
BstNSI	RCATGY	2 cut(s)	176, 758
BstSFI	CTRYAG	2 cut(s)	303, 708
BstV1I	GCAGC	4 cut(s)	46, 409, 810, 849
BstX2I	RGATCY	1 cut(s)	230
BstYI	RGATCY	1 cut(s)	230
BtsI	GCAGTG	1 cut(s)	312
BtsIMutI	CAGTG	2 cut(s)	312, 494
Cac8I	GCNNGC	1 cut(s)	906
CaiI	CAGNNNCTG	1 cut(s)	820
Cfr13I	GGNCC	1 cut(s)	593
CviAII	CATG	6 cut(s)	56, 173, 205, 563, 755, 877
CviJI	RGCY	6 cut(s)	21, 413, 467, 704, 862, 904
CviKI_1	RGCY	6 cut(s)	21, 413, 467, 704, 862, 904
DdeI	CTNAG	2 cut(s)	681, 774
DpnI	GATC	1 cut(s)	232
DpnII	GATC	1 cut(s)	230
DraIII	CACNNNGTG	1 cut(s)	463
Eam1104I	CTCTTC	2 cut(s)	132, 417
EarI	CTCTTC	2 cut(s)	132, 417
Eco47I	GGWCC	1 cut(s)	593
Eco57I	CTGAAG	1 cut(s)	884
FaeI	CATG	6 cut(s)	59, 176, 208, 566, 758, 880
FatI	CATG	6 cut(s)	55, 172, 204, 562, 754, 876
FauNDI	CATATG	1 cut(s)	72
Fnu4HI	GCNGC	4 cut(s)	35, 398, 824, 863
Fsp4HI	GCNGC	4 cut(s)	35, 398, 824, 863
FspBI	CTAG	1 cut(s)	414
GluI	GCNGC	4 cut(s)	35, 398, 824, 863
Hin1II	CATG	6 cut(s)	59, 176, 208, 566, 758, 880
HphI	GGTGA	1 cut(s)	223
Hpy188I	TCNGA	5 cut(s)	66, 334, 625, 741, 775
Hpy188III	TCNNGA	3 cut(s)	118, 419, 591
HpyAV	CCTTC	2 cut(s)	202, 874
HpyCH4III	ACNGT	3 cut(s)	489, 558, 709
HpyCH4IV	ACGT	2 cut(s)	343, 792
HpyF10VI	GCNNNNNNNGC	2 cut(s)	578, 820
HpyF3I	CTNAG	2 cut(s)	681, 774
HpySE526I	ACGT	2 cut(s)	343, 792
Hsp92II	CATG	6 cut(s)	59, 176, 208, 566, 758, 880
Kzo9I	GATC	1 cut(s)	230
LguI	GCTCTTC	2 cut(s)	132, 417
LpnPI	CCDG	8 cut(s)	576, 609, 653, 767, 788, 830, 851, 872
Lsp1109I	GCAGC	4 cut(s)	46, 409, 810, 849
MaeI	CTAG	1 cut(s)	414
MaeII	ACGT	2 cut(s)	343, 792
MaeIII	GTNAC	3 cut(s)	298, 373, 558
MalI	GATC	1 cut(s)	232
MboI	GATC	1 cut(s)	230
MboII	GAAGA	7 cut(s)	20, 149, 225, 368, 371, 434, 494
MfeI	CAATTG	1 cut(s)	506
MflI	RGATCY	1 cut(s)	230
MluCI	AATT	8 cut(s)	449, 506, 582, 648, 653, 715, 735, 743
MnlI	CCTC	2 cut(s)	592, 769
MroXI	GAANNNNTTC	1 cut(s)	582
MseI	TTAA	4 cut(s)	656, 795, 837, 919
MslI	CAYNNNNRTG	3 cut(s)	209, 839, 881
MunI	CAATTG	1 cut(s)	506
MwoI	GCNNNNNNNGC	2 cut(s)	578, 820
NdeI	CATATG	1 cut(s)	72
NdeII	GATC	1 cut(s)	230
NlaIII	CATG	6 cut(s)	59, 176, 208, 566, 758, 880
NmuCI	GTSAC	1 cut(s)	373
NspI	RCATGY	2 cut(s)	176, 758
PciI	ACATGT	2 cut(s)	172, 754
PciSI	GCTCTTC	2 cut(s)	132, 417
PdmI	GAANNNNTTC	1 cut(s)	582
PkrI	GCNGC	4 cut(s)	36, 399, 825, 864
Ppu21I	YACGTR	1 cut(s)	344
PscI	ACATGT	2 cut(s)	172, 754
Psp1406I	AACGTT	1 cut(s)	792
PspPI	GGNCC	1 cut(s)	593
PstI	CTGCAG	1 cut(s)	307
PstNI	CAGNNNCTG	1 cut(s)	820
PsuI	RGATCY	1 cut(s)	230
RseI	CAYNNNNRTG	3 cut(s)	209, 839, 881
SapI	GCTCTTC	2 cut(s)	132, 417
SaqAI	TTAA	4 cut(s)	656, 795, 837, 919
SatI	GCNGC	4 cut(s)	35, 398, 824, 863
Sau3AI	GATC	1 cut(s)	230
Sau96I	GGNCC	1 cut(s)	593
SfcI	CTRYAG	2 cut(s)	303, 708
SinI	GGWCC	1 cut(s)	593
SmiMI	CAYNNNNRTG	3 cut(s)	209, 839, 881
Sse9I	AATT	8 cut(s)	449, 506, 582, 648, 653, 715, 735, 743
SsiI	CCGC	1 cut(s)	638
SspI	AATATT	2 cut(s)	328, 724
SspMI	CTAG	1 cut(s)	414
TaaI	ACNGT	3 cut(s)	489, 558, 709
TaiI	ACGT	2 cut(s)	346, 795
TaqII	GACCGA	1 cut(s)	576
TasI	AATT	8 cut(s)	449, 506, 582, 648, 653, 715, 735, 743
Tru1I	TTAA	4 cut(s)	656, 795, 837, 919
Tru9I	TTAA	4 cut(s)	656, 795, 837, 919
TscAI	CASTG	2 cut(s)	312, 494
TseFI	GTSAC	1 cut(s)	373
TseI	GCWGC	4 cut(s)	34, 397, 823, 862
Tsp45I	GTSAC	1 cut(s)	373
TspDTI	ATGAA	7 cut(s)	72, 150, 221, 264, 276, 369, 893
TspRI	CASTG	2 cut(s)	312, 494
VpaK11BI	GGWCC	1 cut(s)	593
XapI	RAATTY	1 cut(s)	743
XceI	RCATGY	2 cut(s)	176, 758
XmnI	GAANNNNTTC	1 cut(s)	582
XspI	CTAG	1 cut(s)	414

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.