Rmu_co8405049.1_g000002

E2F transcription factor-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8405049.1
Physical Location & Seq
Reverse (-)
937 .. 1260
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8405049.1_g000002.1.cds

Sequence Viewer

Length: 324 bp
ctgacgaatgcgagtagtaagaggagcaaggttgtggagaagagagttcaagatcagggtgaggttgagaactgcaattcggatggcggtggtggggcgaaggagagttcgaagagctaccagtttggtcctttcgctccggtggtggttccaagagctaggaagggtgttgacgtcaacaaggtttgctgggagagtctgggggcttattatcggcctcagtatcagaaccaagcgatgaaggagctgttttcgcattatagggaagcgtggatgttgtggaactctcaagttgctgagaagaatccaattcagagttcttga

Protein Analysis

107

Amino Acids

12.05

Weight (kDa)

9.17

Isoelectric Point (pI)

51.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000573)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G48160 AT3G48160
fragaria_vesca FvH4_3g21790 FvH4_5g16330 FvH4_5g16330 FvH4_5g16330 FvH4_5g16330 FvH4_5g16330 FvH4_5g16330 FvH4_5g16330 FvH4_5g16330 FvH4_5g16330 FvH4_5g16330 FvH4_5g16330 FvH4_5g16330 FvH4_5g16330
malus_domestica MD06G1181700.v1.1 MD14G1187600.v1.1
prunus_persica Prupe.5G180000_v2.0.a1 Prupe.5G180000_v2.0.a1 Prupe.5G180000_v2.0.a1 Prupe.5G180000_v2.0.a1
pyrus_communis pycom06g16070 pycom14g15550
rosa_chinensis RchiOBHm_Chr2g0100091 RchiOBHm_Chr2g0131211 RchiOBHm_Chr2g0131231 RchiOBHm_Chr2g0155761 RchiOBHm_Chr5g0037341 RchiOBHm_Chr6g0286771 RchiOBHm_Chr7g0179801
rosa_laevigata RLG00000005323 RLG00000033775
rosa_multiflora Rmu_co8405049.1_g000002 Rmu_sc0003547.1_g000004 Rmu_sc0004156.1_g000008 Rmu_sc0007546.1_g000012 Rmu_sc0026307.1_g000001 Rmu_sc0032585.1_g000001 Rmu_ssc0000019.1_g000022
rosa_roxburghii Rroxscaffold_1G00027620 Rroxscaffold_1G00027630 Rroxscaffold_1G00043630 Rroxscaffold_2G00107640 Rroxscaffold_3G00273460 Rroxscaffold_5G00347960 Rroxscaffold_5G00350580 Rroxscaffold_5G00366890 Rroxscaffold_6G00391730 Rroxscaffold_6G00392580 Rroxscaffold_7G00170270 Rroxscaffold_7G00170280
rosa_rugosa Rorug02G0499800 Rorug04G0099000 Rorug04G0116000 Rorug05G0129300 Rorug05G0164200 Rorug06G0428300 Rorug06G0428400
rosa_samantha Rh1DG306200 Rh2AG348600 Rh2CG139500 Rh2CG334400 Rh2CG334500 Rh2CG334700 Rh2DG139800 Rh2DG373800 Rh5BG255900 Rh5CG289000 Rh5DG264300 Rh5DG449300 Rh6AG295400 Rh6BG299400 Rh6CG299300 Rh6DG291200 Rh7AG028200 Rh7BG027100 Rh7BG173900 Rh7CG029000 Rh7DG028500
rosa_wichuraiana Rw5G023500 Rw7G002240

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 177
AciI CCGC 1 cut(s) 87
AcyI GRCGYC 1 cut(s) 174
AgsI TTSAA 1 cut(s) 50
AjuI GAANNNNNNNTTGG 1 cut(s) 301
AluBI AGCT 3 cut(s) 117, 158, 247
AluI AGCT 3 cut(s) 117, 158, 247
AoxI GGCC 1 cut(s) 215
AspS9I GGNCC 1 cut(s) 128
AsuHPI GGTGA 1 cut(s) 71
AsuII TTCGAA 1 cut(s) 110
AvaII GGWCC 1 cut(s) 128
BccI CCATC 1 cut(s) 77
BfaI CTAG 1 cut(s) 159
Bme18I GGWCC 1 cut(s) 128
BmgT120I GGNCC 1 cut(s) 128
BmiI GGNNCC 1 cut(s) 150
Bpu14I TTCGAA 1 cut(s) 110
BpuEI CTTGAG 1 cut(s) 273
BsaHI GRCGYC 1 cut(s) 174
BsaWI WCCGGW 1 cut(s) 139
Bse1I ACTGG 1 cut(s) 121
BseGI GGATG 2 cut(s) 88, 279
BseMII CTCAG 2 cut(s) 233, 288
BseNI ACTGG 1 cut(s) 121
BseRI GAGGAG 1 cut(s) 37
BseYI CCCAGC 1 cut(s) 189
BshFI GGCC 1 cut(s) 217
BsiSI CCGG 1 cut(s) 140
BsmI GAATGC 1 cut(s) 13
BsnI GGCC 1 cut(s) 217
Bsp119I TTCGAA 1 cut(s) 110
Bsp143I GATC 1 cut(s) 52
BspACI CCGC 1 cut(s) 87
BspANI GGCC 1 cut(s) 217
BspCNI CTCAG 2 cut(s) 232, 289
BspLI GGNNCC 1 cut(s) 150
BspQI GCTCTTC 1 cut(s) 107
BspT104I TTCGAA 1 cut(s) 110
BsrI ACTGG 1 cut(s) 121
BssMI GATC 1 cut(s) 52
BssNI GRCGYC 1 cut(s) 174
Bst6I CTCTTC 2 cut(s) 35, 107
BstACI GRCGYC 1 cut(s) 174
BstBI TTCGAA 1 cut(s) 110
BstDEI CTNAG 2 cut(s) 219, 297
BstF5I GGATG 2 cut(s) 88, 279
BstKTI GATC 1 cut(s) 55
BstMBI GATC 1 cut(s) 52
BstMWI GCNNNNNNNGC 1 cut(s) 253
BsuRI GGCC 1 cut(s) 217
BtgZI GCGATG 1 cut(s) 251
BtsCI GGATG 2 cut(s) 88, 279
Cfr13I GGNCC 1 cut(s) 128
CviJI RGCY 5 cut(s) 117, 158, 206, 217, 247
CviKI_1 RGCY 5 cut(s) 117, 158, 206, 217, 247
DdeI CTNAG 2 cut(s) 219, 297
DpnI GATC 1 cut(s) 54
DpnII GATC 1 cut(s) 52
Eam1104I CTCTTC 2 cut(s) 35, 107
EarI CTCTTC 2 cut(s) 35, 107
Eco47I GGWCC 1 cut(s) 128
FaiI YATR 1 cut(s) 261
FokI GGATG 2 cut(s) 95, 286
FspBI CTAG 1 cut(s) 159
GsaI CCCAGC 1 cut(s) 193
HaeIII GGCC 1 cut(s) 217
HapII CCGG 1 cut(s) 140
Hin1I GRCGYC 1 cut(s) 174
HincII GTYRAC 2 cut(s) 172, 178
HindII GTYRAC 2 cut(s) 172, 178
HinfI GANTC 2 cut(s) 196, 304
HpaII CCGG 1 cut(s) 140
HphI GGTGA 1 cut(s) 71
Hpy166II GTNNAC 2 cut(s) 172, 178
Hpy188I TCNGA 3 cut(s) 82, 228, 315
Hpy188III TCNNGA 2 cut(s) 50, 321
Hpy8I GTNNAC 2 cut(s) 172, 178
HpyAV CCTTC 3 cut(s) 94, 157, 235
HpyCH4IV ACGT 1 cut(s) 174
HpyCH4V TGCA 1 cut(s) 75
HpyF10VI GCNNNNNNNGC 1 cut(s) 253
HpyF3I CTNAG 2 cut(s) 219, 297
HpySE526I ACGT 1 cut(s) 174
Hsp92I GRCGYC 1 cut(s) 174
Kzo9I GATC 1 cut(s) 52
LguI GCTCTTC 1 cut(s) 107
LmnI GCTCC 3 cut(s) 24, 142, 244
LpnPI CCDG 5 cut(s) 41, 134, 153, 175, 185
MaeI CTAG 1 cut(s) 159
MaeII ACGT 1 cut(s) 174
MalI GATC 1 cut(s) 54
MboI GATC 1 cut(s) 52
MboII GAAGA 3 cut(s) 52, 124, 313
MluCI AATT 2 cut(s) 76, 309
MlyI GAGTC 1 cut(s) 205
MnlI CCTC 3 cut(s) 15, 55, 228
MspI CCGG 1 cut(s) 140
Mva1269I GAATGC 1 cut(s) 13
MwoI GCNNNNNNNGC 1 cut(s) 253
NdeII GATC 1 cut(s) 52
NlaIV GGNNCC 1 cut(s) 150
NspV TTCGAA 1 cut(s) 110
PciSI GCTCTTC 1 cut(s) 107
PctI GAATGC 1 cut(s) 13
PfeI GAWTC 1 cut(s) 304
PleI GAGTC 1 cut(s) 204
PpsI GAGTC 1 cut(s) 204
PspFI CCCAGC 1 cut(s) 189
PspN4I GGNNCC 1 cut(s) 150
PspPI GGNCC 1 cut(s) 128
SapI GCTCTTC 1 cut(s) 107
Sau3AI GATC 1 cut(s) 52
Sau96I GGNCC 1 cut(s) 128
SchI GAGTC 1 cut(s) 205
SetI ASST 7 cut(s) 33, 66, 119, 160, 177, 186, 249
SfuI TTCGAA 1 cut(s) 110
SinI GGWCC 1 cut(s) 128
SmlI CTYRAG 1 cut(s) 288
SmoI CTYRAG 1 cut(s) 288
Sse9I AATT 2 cut(s) 76, 309
SsiI CCGC 1 cut(s) 87
SspMI CTAG 1 cut(s) 159
TaiI ACGT 1 cut(s) 177
TaqI TCGA 1 cut(s) 110
TasI AATT 2 cut(s) 76, 309
TfiI GAWTC 1 cut(s) 304
TspDTI ATGAA 1 cut(s) 254
VpaK11BI GGWCC 1 cut(s) 128
XspI CTAG 1 cut(s) 159
ZraI GACGTC 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.