Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000147.1

Orthogroup ID

OG0001602

Physical Location & Seq

Genomic Coordinates Forward (+)

442228 .. 445192

Gene Structure 2965 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000147.1_g000100.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1158 bp

atggtccccagaacaggcggcgacgagacaacgactgctagggcaaggagaggcgttgcagtcctctggtttcgtcgatggtgttgtttccagatcgggcattggaatgatcaatatgtgcctgcgtacaatccggcatgggataatcatccctatgcgtggaatggctatctaaactcccaacatggatccttcaatgcgtttgatgcttcttcgtcttcataccatgatcatcagtcgccaacacctgaaggtaactctcttgtagatttggttgcttctatgactaatactgcttcttctcgcatacagagcatgaaatcttatacacaaaatattgaagaatctcttgagaagattgggcaatatgtggagataattttggcctgcttgaatcaagagtcaagagagccagaaccaattcaagagctttcaacaattgaggaggattattggccagcaattaacgagatttgggagagcgcattacctcaagagaactctcttacacatatgacaactctatgggagccccctacagccactgtattgcttcaatctcatgatacatcacgtgactcattcttagatgaggatgaagactacatcatccactacacaaccgagcttgaagcgttggaggaggaagatccctttgatgataaggagttttataatgaagaaagtaaggaggagctttatgacaatgagttcaatgtgccggaagcaatcgccatacctcatgaagatcaagagtgtttcaatgatgatatgggtgattttatagaagaggataccatcaaatcacatatcattggccctctatctctagcacacggtacaccacctgattctcccttgccatattcgagctctacaaatgtttcttccatccaagaaatcattgattttgtcgatcatgtggagatggtcatttgcaagcatttgacatctgataaggagatccttctatccatgcttggtagatctcataggagatggagacaatggaagaagagaaagaaaaagaggatcatccaatcccatgtttccattactcccaagctacccaagttgttatcaaaagatcatgaaacttcacttaaaagggttaaacatttgagggatccaagaccaaaacctcctgattactcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

385

Amino Acids

44.49

Weight (kDa)

4.87

Isoelectric Point (pI)

69.02

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001602)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g24111 FvH4_2g35541
rosa_chinensis	RchiOBHm_Chr2g0136241
rosa_laevigata	RLG00000002772
rosa_multiflora	Rmu_sc0000147.1_g000100 Rmu_sc0000168.1_g000025 Rmu_sc0000334.1_g000016 Rmu_sc0000498.1_g000030 Rmu_sc0000655.1_g000009 Rmu_sc0000698.1_g000093 Rmu_sc0001009.1_g000026 Rmu_sc0001291.1_g000039 Rmu_sc0001891.1_g000019 Rmu_sc0002460.1_g000030 Rmu_sc0002737.1_g000024 Rmu_sc0002935.1_g000018 Rmu_sc0003492.1_g000014 Rmu_sc0004092.1_g000004 Rmu_sc0006648.1_g000003 Rmu_sc0009036.1_g000007 Rmu_sc0009305.1_g000001 Rmu_sc0010589.1_g000004 Rmu_sc0013054.1_g000001 Rmu_sc0016839.1_g000001 Rmu_sc0022803.1_g000001
rosa_roxburghii	Rroxscaffold_1G00002390 Rroxscaffold_1G00003100 Rroxscaffold_2G00077900 Rroxscaffold_2G00116440 Rroxscaffold_3G00224850 Rroxscaffold_3G00235300 Rroxscaffold_3G00265970 Rroxscaffold_3G00274300 Rroxscaffold_4G00329060 Rroxscaffold_4G00332480 Rroxscaffold_5G00335940 Rroxscaffold_5G00337700 Rroxscaffold_5G00378510 Rroxscaffold_6G00388480 Rroxscaffold_6G00389900 Rroxscaffold_6G00391070 Rroxscaffold_6G00392890 Rroxscaffold_6G00394900 Rroxscaffold_6G00399570 Rroxscaffold_6G00414360 Rroxscaffold_7G00187910
rosa_samantha	Rh1DG222000 Rh3CG300900 Rh4AG014900 Rh5DG253600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	675
AciI	CCGC	1 cut(s)	18
AclWI	GGATC	7 cut(s)	183, 196, 644, 958, 1040, 1121, 1134
AcoI	YGGCCR	1 cut(s)	455
AcuI	CTGAAG	1 cut(s)	270
AcvI	CACGTG	1 cut(s)	575
AfaI	GTAC	2 cut(s)	128, 841
AfiI	CCNNNNNNNGG	2 cut(s)	14, 159
AgsI	TTSAA	9 cut(s)	196, 341, 394, 425, 435, 557, 632, 715, 763
AluBI	AGCT	5 cut(s)	430, 628, 697, 873, 1066
AluI	AGCT	5 cut(s)	430, 628, 697, 873, 1066
Alw21I	GWGCWC	1 cut(s)	875
Alw26I	GTCTC	2 cut(s)	20, 997
AlwI	GGATC	7 cut(s)	183, 196, 644, 958, 1040, 1121, 1134
AlwNI	CAGNNNCTG	1 cut(s)	545
AoxI	GGCC	3 cut(s)	384, 455, 817
Asp700I	GAANNNNTTC	1 cut(s)	420
AspLEI	GCGC	1 cut(s)	485
AspS9I	GGNCC	2 cut(s)	4, 818
AsuHPI	GGTGA	1 cut(s)	788
AvaII	GGWCC	1 cut(s)	4
BalI	TGGCCA	1 cut(s)	457
BamHI	GGATCC	2 cut(s)	188, 1126
BanII	GRGCYC	2 cut(s)	534, 875
BbrPI	CACGTG	1 cut(s)	575
BbsI	GAAGAC	2 cut(s)	210, 606
Bbv12I	GWGCWC	1 cut(s)	875
BccI	CCATC	5 cut(s)	72, 806, 899, 922, 993
BciVI	GTATCC	1 cut(s)	787
BclI	TGATCA	2 cut(s)	109, 229
BcoDI	GTCTC	2 cut(s)	20, 997
BfaI	CTAG	2 cut(s)	39, 830
BfmI	CTRYAG	1 cut(s)	537
BfuI	GTATCC	1 cut(s)	787
BglII	AGATCT	1 cut(s)	986
BisI	GCNGC	1 cut(s)	19
BlsI	GCNGC	1 cut(s)	20
Bme18I	GGWCC	1 cut(s)	4
BmgT120I	GGNCC	2 cut(s)	4, 818
BmiI	GGNNCC	4 cut(s)	6, 190, 531, 1128
BmsI	GCATC	1 cut(s)	196
BpiI	GAAGAC	2 cut(s)	210, 606
BpuEI	CTTGAG	2 cut(s)	371, 477
BsaAI	YACGTR	1 cut(s)	575
BsaBI	GATNNNNATC	1 cut(s)	147
Bsc4I	CCNNNNNNNGG	2 cut(s)	14, 159
Bse8I	GATNNNNATC	1 cut(s)	147
BseGI	GGATG	5 cut(s)	148, 601, 609, 891, 1035
BseJI	GATNNNNATC	1 cut(s)	147
BseLI	CCNNNNNNNGG	2 cut(s)	14, 159
BseRI	GAGGAG	3 cut(s)	458, 656, 707
BshFI	GGCC	3 cut(s)	386, 457, 819
BsiHKAI	GWGCWC	1 cut(s)	875
BsiSI	CCGG	2 cut(s)	134, 722
BslI	CCNNNNNNNGG	2 cut(s)	14, 159
BsmAI	GTCTC	2 cut(s)	20, 997
BsnI	GGCC	3 cut(s)	386, 457, 819
Bsp1286I	GDGCHC	2 cut(s)	534, 875
BspACI	CCGC	1 cut(s)	18
BspANI	GGCC	3 cut(s)	386, 457, 819
BspHI	TCATGA	3 cut(s)	562, 742, 1090
BspLI	GGNNCC	4 cut(s)	6, 190, 531, 1128
BspPI	GGATC	7 cut(s)	183, 196, 644, 958, 1040, 1121, 1134
Bst4CI	ACNGT	2 cut(s)	547, 839
Bst6I	CTCTTC	2 cut(s)	783, 1010
BstBAI	YACGTR	1 cut(s)	575
BstC8I	GCNNGC	4 cut(s)	123, 388, 459, 941
BstDEI	CTNAG	1 cut(s)	586
BstF5I	GGATG	5 cut(s)	148, 601, 609, 891, 1035
BstHHI	GCGC	1 cut(s)	485
BstMAI	GTCTC	2 cut(s)	20, 997
BstMWI	GCNNNNNNNGC	2 cut(s)	206, 312
BstSFI	CTRYAG	1 cut(s)	537
BstV2I	GAAGAC	2 cut(s)	210, 606
BstX2I	RGATCY	5 cut(s)	188, 649, 963, 986, 1126
BstYI	RGATCY	5 cut(s)	188, 649, 963, 986, 1126
BsuI	GTATCC	1 cut(s)	787
BsuRI	GGCC	3 cut(s)	386, 457, 819
BtsCI	GGATG	5 cut(s)	148, 601, 609, 891, 1035
BtsIMutI	CAGTG	1 cut(s)	543
Cac8I	GCNNGC	4 cut(s)	123, 388, 459, 941
CaiI	CAGNNNCTG	1 cut(s)	545
CciI	TCATGA	3 cut(s)	562, 742, 1090
CfoI	GCGC	1 cut(s)	485
Cfr13I	GGNCC	2 cut(s)	4, 818
Csp6I	GTAC	2 cut(s)	127, 840
CviQI	GTAC	2 cut(s)	127, 840
DdeI	CTNAG	1 cut(s)	586
EaeI	YGGCCR	1 cut(s)	455
Eam1104I	CTCTTC	2 cut(s)	783, 1010
EarI	CTCTTC	2 cut(s)	783, 1010
Ecl136II	GAGCTC	1 cut(s)	873
Eco24I	GRGCYC	2 cut(s)	534, 875
Eco47I	GGWCC	1 cut(s)	4
Eco53kI	GAGCTC	1 cut(s)	873
Eco57I	CTGAAG	1 cut(s)	270
Eco72I	CACGTG	1 cut(s)	575
EcoICRI	GAGCTC	1 cut(s)	873
EcoT38I	GRGCYC	2 cut(s)	534, 875
FalI	AAGNNNNNCTT	2 cut(s)	333, 365
FauNDI	CATATG	1 cut(s)	513
FbaI	TGATCA	2 cut(s)	109, 229
Fnu4HI	GCNGC	1 cut(s)	19
FokI	GGATG	5 cut(s)	135, 596, 608, 878, 1022
FriOI	GRGCYC	2 cut(s)	534, 875
Fsp4HI	GCNGC	1 cut(s)	19
FspBI	CTAG	2 cut(s)	39, 830
GlaI	GCGC	1 cut(s)	484
GluI	GCNGC	1 cut(s)	19
HaeIII	GGCC	3 cut(s)	386, 457, 819
HapII	CCGG	2 cut(s)	134, 722
HhaI	GCGC	1 cut(s)	485
Hin6I	GCGC	1 cut(s)	483
HinP1I	GCGC	1 cut(s)	483
HinfI	GANTC	5 cut(s)	344, 394, 401, 578, 851
HpaII	CCGG	2 cut(s)	134, 722
HphI	GGTGA	1 cut(s)	788
Hpy166II	GTNNAC	1 cut(s)	842
Hpy188I	TCNGA	1 cut(s)	955
Hpy8I	GTNNAC	1 cut(s)	842
Hpy99I	CGWCG	2 cut(s)	26, 78
HpyAV	CCTTC	3 cut(s)	202, 245, 977
HpyCH4III	ACNGT	2 cut(s)	547, 839
HpyCH4IV	ACGT	1 cut(s)	574
HpyCH4V	TGCA	2 cut(s)	59, 939
HpyF10VI	GCNNNNNNNGC	2 cut(s)	206, 312
HpyF3I	CTNAG	1 cut(s)	586
HpySE526I	ACGT	1 cut(s)	574
HspAI	GCGC	1 cut(s)	483
Ksp22I	TGATCA	2 cut(s)	109, 229
LmnI	GCTCC	2 cut(s)	529, 694
LweI	GCATC	1 cut(s)	196
MaeI	CTAG	2 cut(s)	39, 830
MaeII	ACGT	1 cut(s)	574
MaeIII	GTNAC	2 cut(s)	254, 575
MfeI	CAATTG	1 cut(s)	438
MflI	RGATCY	5 cut(s)	188, 649, 963, 986, 1126
MhlI	GDGCHC	2 cut(s)	534, 875
MlsI	TGGCCA	1 cut(s)	457
MluCI	AATT	4 cut(s)	378, 420, 438, 462
MluNI	TGGCCA	1 cut(s)	457
MlyI	GAGTC	2 cut(s)	410, 572
MmeI	TCCRAC	1 cut(s)	618
Mox20I	TGGCCA	1 cut(s)	457
MroXI	GAANNNNTTC	1 cut(s)	420
MscI	TGGCCA	1 cut(s)	457
MseI	TTAA	3 cut(s)	465, 1104, 1113
MslI	CAYNNNNRTG	2 cut(s)	105, 153
Msp20I	TGGCCA	1 cut(s)	457
MspI	CCGG	2 cut(s)	134, 722
MunI	CAATTG	1 cut(s)	438
MwoI	GCNNNNNNNGC	2 cut(s)	206, 312
NdeI	CATATG	1 cut(s)	513
NlaIV	GGNNCC	4 cut(s)	6, 190, 531, 1128
NmuCI	GTSAC	1 cut(s)	575
PagI	TCATGA	3 cut(s)	562, 742, 1090
PdmI	GAANNNNTTC	1 cut(s)	420
PfeI	GAWTC	3 cut(s)	344, 394, 851
PkrI	GCNGC	1 cut(s)	20
PleI	GAGTC	2 cut(s)	409, 572
PmaCI	CACGTG	1 cut(s)	575
PmlI	CACGTG	1 cut(s)	575
PpsI	GAGTC	2 cut(s)	409, 572
Ppu21I	YACGTR	1 cut(s)	575
PsiI	TTATAA	1 cut(s)	675
Psp124BI	GAGCTC	1 cut(s)	875
PspCI	CACGTG	1 cut(s)	575
PspN4I	GGNNCC	4 cut(s)	6, 190, 531, 1128
PspPI	GGNCC	2 cut(s)	4, 818
PstNI	CAGNNNCTG	1 cut(s)	545
PsuI	RGATCY	5 cut(s)	188, 649, 963, 986, 1126
RsaI	GTAC	2 cut(s)	128, 841
RsaNI	GTAC	2 cut(s)	127, 840
RseI	CAYNNNNRTG	2 cut(s)	105, 153
SacI	GAGCTC	1 cut(s)	875
SaqAI	TTAA	3 cut(s)	465, 1104, 1113
SatI	GCNGC	1 cut(s)	19
Sau96I	GGNCC	2 cut(s)	4, 818
SchI	GAGTC	2 cut(s)	410, 572
SduI	GDGCHC	2 cut(s)	534, 875
SfaNI	GCATC	1 cut(s)	196
SfcI	CTRYAG	1 cut(s)	537
SinI	GGWCC	1 cut(s)	4
SmiMI	CAYNNNNRTG	2 cut(s)	105, 153
SmlI	CTYRAG	2 cut(s)	350, 492
SmoI	CTYRAG	2 cut(s)	350, 492
Sse9I	AATT	4 cut(s)	378, 420, 438, 462
SsiI	CCGC	1 cut(s)	18
SspI	AATATT	1 cut(s)	337
SspMI	CTAG	2 cut(s)	39, 830
SstI	GAGCTC	1 cut(s)	875
TaaI	ACNGT	2 cut(s)	547, 839
TaiI	ACGT	1 cut(s)	577
TaqI	TCGA	3 cut(s)	76, 869, 915
TasI	AATT	4 cut(s)	378, 420, 438, 462
TauI	GCSGC	1 cut(s)	21
TfiI	GAWTC	3 cut(s)	344, 394, 851
Tru1I	TTAA	3 cut(s)	465, 1104, 1113
Tru9I	TTAA	3 cut(s)	465, 1104, 1113
TscAI	CASTG	1 cut(s)	550
TseFI	GTSAC	1 cut(s)	575
Tsp45I	GTSAC	1 cut(s)	575
TspDTI	ATGAA	6 cut(s)	210, 332, 612, 693, 759, 1107
TspRI	CASTG	1 cut(s)	550
VpaK11BI	GGWCC	1 cut(s)	4
XmnI	GAANNNNTTC	1 cut(s)	420
XspI	CTAG	2 cut(s)	39, 830

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.