Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000655.1

Orthogroup ID

OG0001602

Physical Location & Seq

Genomic Coordinates Forward (+)

67069 .. 68193

Gene Structure 1125 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000655.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1125 bp

atggagacatgtccaagcatccaatatcaaggatactatgatcaaaataccatgcttggaggatttcatgacaaccaagggcattggaataattattattcacctccatacaatctggcatgggataatcctccttactcttcgtggaatgacgatccaaacgtgcaacaaggatctttcaatgagtttgaagcttccccatattcataccatgaatattgtccacaagcaccacctcctcaaaactcaggtatgtctaataatgatgatgagattattaaggaactaaatgctgctactcaagctttgattcagggacaacaatcttcagatgcttcttttcaagcttggattcaggaaaagcaagctcttgatgatgatttggtagaaaaactaaagagtttggagaacttaatatctcaggagcacccttctaaaccgattgaaactttagaggagctcccgacaactacagatttgtgccaaccccatgatgcattccatgattcaaaatttgatgaggatgtagtaatggatttggaggagtcttataaagagccgctcaacgttgagatttttgaggatcactacatgaccgagcttgaaaagtgggaaatggaagatcccttcgatgatgaggaatcctatcatgaagaaagtaaggatgagcttcatgcaaatgtgccccaagtgcctgaaacaatcatgctacctcacgaagatccaagaggttacacaatggaggatttcttaaaagagaaactcatcaaagctcctacatttgggcctttattgctagcacatggaagaccatctgatccttcaacacctcattcaagctctatacatgttctgcccatccaagctaagtttgagtttgttgatcatgtggagatggtgatatgtgaacatcttgaatcagataaggagatcattctagctgtgattgtcgaacttaagaaaagatggagacaatggaagaagagaaagaaaaatagaagcatcaaatcctatctttccattgctcccatgttacctaagttgctagcaagggaccatgaaacatctttgaagaggcttaagcatttgatcgaaccgcggcctaaaccttctgattactcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Retrotrans_gag rve

Protein Analysis

374

Amino Acids

43.44

Weight (kDa)

4.73

Isoelectric Point (pI)

53.43

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001602)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g24111 FvH4_2g35541
rosa_chinensis	RchiOBHm_Chr2g0136241
rosa_laevigata	RLG00000002772
rosa_multiflora	Rmu_sc0000147.1_g000100 Rmu_sc0000168.1_g000025 Rmu_sc0000334.1_g000016 Rmu_sc0000498.1_g000030 Rmu_sc0000655.1_g000009 Rmu_sc0000698.1_g000093 Rmu_sc0001009.1_g000026 Rmu_sc0001291.1_g000039 Rmu_sc0001891.1_g000019 Rmu_sc0002460.1_g000030 Rmu_sc0002737.1_g000024 Rmu_sc0002935.1_g000018 Rmu_sc0003492.1_g000014 Rmu_sc0004092.1_g000004 Rmu_sc0006648.1_g000003 Rmu_sc0009036.1_g000007 Rmu_sc0009305.1_g000001 Rmu_sc0010589.1_g000004 Rmu_sc0013054.1_g000001 Rmu_sc0016839.1_g000001 Rmu_sc0022803.1_g000001
rosa_roxburghii	Rroxscaffold_1G00002390 Rroxscaffold_1G00003100 Rroxscaffold_2G00077900 Rroxscaffold_2G00116440 Rroxscaffold_3G00224850 Rroxscaffold_3G00235300 Rroxscaffold_3G00265970 Rroxscaffold_3G00274300 Rroxscaffold_4G00329060 Rroxscaffold_4G00332480 Rroxscaffold_5G00335940 Rroxscaffold_5G00337700 Rroxscaffold_5G00378510 Rroxscaffold_6G00388480 Rroxscaffold_6G00389900 Rroxscaffold_6G00391070 Rroxscaffold_6G00392890 Rroxscaffold_6G00394900 Rroxscaffold_6G00399570 Rroxscaffold_6G00414360 Rroxscaffold_7G00187910
rosa_samantha	Rh1DG222000 Rh3CG300900 Rh4AG014900 Rh5DG253600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	552
AccBSI	CCGCTC	1 cut(s)	562
AccII	CGCG	1 cut(s)	1099
AciI	CCGC	3 cut(s)	560, 1097, 1099
AclI	AACGTT	1 cut(s)	567
AclWI	GGATC	6 cut(s)	149, 181, 591, 617, 716, 812
AcsI	RAATTY	1 cut(s)	512
AcuI	CTGAAG	1 cut(s)	312
AfiI	CCNNNNNNNGG	1 cut(s)	782
AflII	CTTAAG	2 cut(s)	956, 1079
AflIII	ACRYGT	2 cut(s)	8, 847
Alw21I	GWGCWC	2 cut(s)	429, 462
Alw26I	GTCTC	1 cut(s)	964
AlwI	GGATC	6 cut(s)	149, 181, 591, 617, 716, 812
AoxI	GGCC	2 cut(s)	785, 1100
ApeKI	GCWGC	1 cut(s)	293
ApoI	RAATTY	1 cut(s)	512
AspS9I	GGNCC	2 cut(s)	785, 1054
AsuHPI	GGTGA	2 cut(s)	93, 910
AsuNHI	GCTAGC	2 cut(s)	796, 1045
AvaII	GGWCC	1 cut(s)	1054
BaeGI	GKGCMC	1 cut(s)	687
BanII	GRGCYC	1 cut(s)	462
BbsI	GAAGAC	1 cut(s)	814
Bbv12I	GWGCWC	2 cut(s)	429, 462
BbvI	GCAGC	1 cut(s)	280
BccI	CCATC	4 cut(s)	820, 866, 889, 960
BciVI	GTATCC	1 cut(s)	26
BclI	TGATCA	2 cut(s)	40, 883
BcoDI	GTCTC	1 cut(s)	964
BfaI	CTAG	3 cut(s)	797, 938, 1046
BfmI	CTRYAG	1 cut(s)	471
BfrI	CTTAAG	2 cut(s)	956, 1079
BfuI	GTATCC	1 cut(s)	26
BisI	GCNGC	3 cut(s)	294, 560, 1100
BlsI	GCNGC	3 cut(s)	295, 561, 1101
Bme18I	GGWCC	1 cut(s)	1054
BmgT120I	GGNCC	2 cut(s)	785, 1054
BmiI	GGNNCC	1 cut(s)	1055
BmsI	GCATC	4 cut(s)	27, 322, 484, 1011
BmtI	GCTAGC	2 cut(s)	800, 1049
BpiI	GAAGAC	1 cut(s)	814
BpuEI	CTTGAG	1 cut(s)	285
BsaJI	CCNNGG	2 cut(s)	76, 1097
Bsc4I	CCNNNNNNNGG	1 cut(s)	782
Bse3DI	GCAATG	1 cut(s)	1020
BseDI	CCNNGG	2 cut(s)	76, 1097
BseGI	GGATG	4 cut(s)	18, 529, 670, 858
BseLI	CCNNNNNNNGG	1 cut(s)	782
BseMI	GCAATG	1 cut(s)	1020
BseMII	CTCAG	2 cut(s)	261, 434
BseRI	GAGGAG	3 cut(s)	228, 470, 557
BseSI	GKGCMC	1 cut(s)	687
BseXI	GCAGC	1 cut(s)	280
Bsh1236I	CGCG	1 cut(s)	1099
BshFI	GGCC	2 cut(s)	787, 1102
BsiHKAI	GWGCWC	2 cut(s)	429, 462
BslFI	GGGAC	2 cut(s)	330, 1067
BslI	CCNNNNNNNGG	1 cut(s)	782
BsmAI	GTCTC	1 cut(s)	964
BsmFI	GGGAC	2 cut(s)	330, 1067
BsmI	GAATGC	1 cut(s)	497
BsnI	GGCC	2 cut(s)	787, 1102
Bsp1286I	GDGCHC	3 cut(s)	429, 462, 687
BspACI	CCGC	3 cut(s)	560, 1097, 1099
BspANI	GGCC	2 cut(s)	787, 1102
BspCNI	CTCAG	2 cut(s)	260, 433
BspFNI	CGCG	1 cut(s)	1099
BspHI	TCATGA	2 cut(s)	67, 649
BspLI	GGNNCC	1 cut(s)	1055
BspOI	GCTAGC	2 cut(s)	800, 1049
BspPI	GGATC	6 cut(s)	149, 181, 591, 617, 716, 812
BspTI	CTTAAG	2 cut(s)	956, 1079
BsrBI	CCGCTC	1 cut(s)	562
BsrDI	GCAATG	1 cut(s)	1020
BssECI	CCNNGG	2 cut(s)	76, 1097
BssT1I	CCWWGG	1 cut(s)	76
Bst6I	CTCTTC	3 cut(s)	145, 977, 1067
BstAFI	CTTAAG	2 cut(s)	956, 1079
BstC8I	GCNNGC	3 cut(s)	366, 798, 1047
BstDEI	CTNAG	4 cut(s)	247, 420, 867, 1038
BstDSI	CCRYGG	1 cut(s)	1097
BstF5I	GGATG	4 cut(s)	18, 529, 670, 858
BstFNI	CGCG	1 cut(s)	1099
BstMAI	GTCTC	1 cut(s)	964
BstMWI	GCNNNNNNNGC	3 cut(s)	302, 691, 793
BstNSI	RCATGY	2 cut(s)	12, 851
BstSFI	CTRYAG	1 cut(s)	471
BstSLI	GKGCMC	1 cut(s)	687
BstUI	CGCG	1 cut(s)	1099
BstV1I	GCAGC	1 cut(s)	280
BstV2I	GAAGAC	1 cut(s)	814
BstX2I	RGATCY	3 cut(s)	173, 622, 721
BstYI	RGATCY	3 cut(s)	173, 622, 721
BsuI	GTATCC	1 cut(s)	26
BsuRI	GGCC	2 cut(s)	787, 1102
BtgI	CCRYGG	1 cut(s)	1097
BtsCI	GGATG	4 cut(s)	18, 529, 670, 858
Cac8I	GCNNGC	3 cut(s)	366, 798, 1047
CciI	TCATGA	2 cut(s)	67, 649
Cfr13I	GGNCC	2 cut(s)	785, 1054
Cfr42I	CCGCGG	1 cut(s)	1100
DdeI	CTNAG	4 cut(s)	247, 420, 867, 1038
Eam1104I	CTCTTC	3 cut(s)	145, 977, 1067
EarI	CTCTTC	3 cut(s)	145, 977, 1067
Ecl136II	GAGCTC	1 cut(s)	460
Eco130I	CCWWGG	1 cut(s)	76
Eco24I	GRGCYC	1 cut(s)	462
Eco47I	GGWCC	1 cut(s)	1054
Eco53kI	GAGCTC	1 cut(s)	460
Eco57I	CTGAAG	1 cut(s)	312
EcoICRI	GAGCTC	1 cut(s)	460
EcoT14I	CCWWGG	1 cut(s)	76
EcoT22I	ATGCAT	1 cut(s)	499
EcoT38I	GRGCYC	1 cut(s)	462
ErhI	CCWWGG	1 cut(s)	76
FaqI	GGGAC	2 cut(s)	330, 1067
FbaI	TGATCA	2 cut(s)	40, 883
Fnu4HI	GCNGC	3 cut(s)	294, 560, 1100
FokI	GGATG	4 cut(s)	5, 536, 677, 845
FriOI	GRGCYC	1 cut(s)	462
Fsp4HI	GCNGC	3 cut(s)	294, 560, 1100
FspBI	CTAG	3 cut(s)	797, 938, 1046
GluI	GCNGC	3 cut(s)	294, 560, 1100
HaeIII	GGCC	2 cut(s)	787, 1102
HindIII	AAGCTT	3 cut(s)	192, 303, 345
HinfI	GANTC	6 cut(s)	310, 352, 506, 545, 641, 917
HphI	GGTGA	2 cut(s)	93, 910
Hpy166II	GTNNAC	2 cut(s)	224, 908
Hpy188I	TCNGA	4 cut(s)	331, 817, 922, 1114
Hpy188III	TCNNGA	9 cut(s)	68, 356, 371, 422, 463, 650, 716, 914, 1122
Hpy8I	GTNNAC	2 cut(s)	224, 908
HpyAV	CCTTC	4 cut(s)	441, 637, 831, 1119
HpyCH4IV	ACGT	2 cut(s)	162, 567
HpyCH4V	TGCA	3 cut(s)	166, 497, 677
HpyF10VI	GCNNNNNNNGC	3 cut(s)	302, 691, 793
HpyF3I	CTNAG	4 cut(s)	247, 420, 867, 1038
HpySE526I	ACGT	2 cut(s)	162, 567
Ksp22I	TGATCA	2 cut(s)	40, 883
KspI	CCGCGG	1 cut(s)	1100
LmnI	GCTCC	5 cut(s)	424, 457, 465, 778, 1030
LpnPI	CCDG	6 cut(s)	101, 234, 299, 341, 407, 708
Lsp1109I	GCAGC	1 cut(s)	280
LweI	GCATC	4 cut(s)	27, 322, 484, 1011
MaeI	CTAG	3 cut(s)	797, 938, 1046
MaeII	ACGT	2 cut(s)	162, 567
MaeIII	GTNAC	2 cut(s)	731, 1032
MbiI	CCGCTC	1 cut(s)	562
MboII	GAAGA	9 cut(s)	132, 318, 632, 665, 731, 819, 991, 994, 1084
MflI	RGATCY	3 cut(s)	173, 622, 721
MhlI	GDGCHC	3 cut(s)	429, 462, 687
MluCI	AATT	2 cut(s)	91, 512
MlyI	GAGTC	1 cut(s)	554
Mph1103I	ATGCAT	1 cut(s)	499
MseI	TTAA	5 cut(s)	279, 413, 752, 957, 1080
MslI	CAYNNNNRTG	1 cut(s)	678
MspA1I	CMGCKG	1 cut(s)	1099
MspCI	CTTAAG	2 cut(s)	956, 1079
Mva1269I	GAATGC	1 cut(s)	497
MvnI	CGCG	1 cut(s)	1099
MwoI	GCNNNNNNNGC	3 cut(s)	302, 691, 793
NheI	GCTAGC	2 cut(s)	796, 1045
NlaIV	GGNNCC	1 cut(s)	1055
NsiI	ATGCAT	1 cut(s)	499
NspI	RCATGY	2 cut(s)	12, 851
PagI	TCATGA	2 cut(s)	67, 649
PciI	ACATGT	2 cut(s)	8, 847
PcsI	WCGNNNNNNNCGW	1 cut(s)	159
PctI	GAATGC	1 cut(s)	497
PfeI	GAWTC	5 cut(s)	310, 352, 506, 641, 917
PkrI	GCNGC	3 cut(s)	295, 561, 1101
PleI	GAGTC	1 cut(s)	553
PpsI	GAGTC	1 cut(s)	553
PscI	ACATGT	2 cut(s)	8, 847
PsiI	TTATAA	1 cut(s)	552
Psp124BI	GAGCTC	1 cut(s)	462
Psp1406I	AACGTT	1 cut(s)	567
PspN4I	GGNNCC	1 cut(s)	1055
PspPI	GGNCC	2 cut(s)	785, 1054
PsuI	RGATCY	3 cut(s)	173, 622, 721
RseI	CAYNNNNRTG	1 cut(s)	678
SacI	GAGCTC	1 cut(s)	462
SacII	CCGCGG	1 cut(s)	1100
SaqAI	TTAA	5 cut(s)	279, 413, 752, 957, 1080
SatI	GCNGC	3 cut(s)	294, 560, 1100
Sau96I	GGNCC	2 cut(s)	785, 1054
SchI	GAGTC	1 cut(s)	554
SduI	GDGCHC	3 cut(s)	429, 462, 687
SfaNI	GCATC	4 cut(s)	27, 322, 484, 1011
SfcI	CTRYAG	1 cut(s)	471
Sfr303I	CCGCGG	1 cut(s)	1100
SgrBI	CCGCGG	1 cut(s)	1100
SinI	GGWCC	1 cut(s)	1054
SmiMI	CAYNNNNRTG	1 cut(s)	678
SmlI	CTYRAG	3 cut(s)	300, 956, 1079
SmoI	CTYRAG	3 cut(s)	300, 956, 1079
Sse9I	AATT	2 cut(s)	91, 512
SsiI	CCGC	3 cut(s)	560, 1097, 1099
SspI	AATATT	1 cut(s)	218
SspMI	CTAG	3 cut(s)	797, 938, 1046
SstI	GAGCTC	1 cut(s)	462
StyI	CCWWGG	1 cut(s)	76
TaiI	ACGT	2 cut(s)	165, 570
TaqI	TCGA	3 cut(s)	630, 951, 1092
TaqII	GACCGA	1 cut(s)	611
TasI	AATT	2 cut(s)	91, 512
TauI	GCSGC	2 cut(s)	562, 1102
TfiI	GAWTC	5 cut(s)	310, 352, 506, 641, 917
Tru1I	TTAA	5 cut(s)	279, 413, 752, 957, 1080
Tru9I	TTAA	5 cut(s)	279, 413, 752, 957, 1080
TseI	GCWGC	1 cut(s)	293
TspDTI	ATGAA	6 cut(s)	56, 195, 228, 662, 666, 1074
Vha464I	CTTAAG	2 cut(s)	956, 1079
VpaK11BI	GGWCC	1 cut(s)	1054
XapI	RAATTY	1 cut(s)	512
XceI	RCATGY	2 cut(s)	12, 851
XspI	CTAG	3 cut(s)	797, 938, 1046
Zsp2I	ATGCAT	1 cut(s)	499

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.